Incidental Mutation 'R5116:Ccr8'
ID394202
Institutional Source Beutler Lab
Gene Symbol Ccr8
Ensembl Gene ENSMUSG00000042262
Gene Namechemokine (C-C motif) receptor 8
SynonymsCmkbr8
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location120092114-120094906 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120094029 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 70 (I70T)
Ref Sequence ENSEMBL: ENSMUSP00000038473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048777]
Predicted Effect probably benign
Transcript: ENSMUST00000048777
AA Change: I70T

PolyPhen 2 Score 0.388 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038473
Gene: ENSMUSG00000042262
AA Change: I70T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 44 313 2.4e-8 PFAM
Pfam:7tm_1 50 298 3.3e-44 PFAM
low complexity region 338 347 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217495
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta chemokine receptor family, which is predicted to be a seven transmembrane protein similar to G protein-coupled receptors. Chemokines and their receptors are important for the migration of various cell types into the inflammatory sites. This receptor protein preferentially expresses in the thymus. I-309, thymus activation-regulated cytokine (TARC) and macrophage inflammatory protein-1 beta (MIP-1 beta) have been identified as ligands of this receptor. Studies of this receptor and its ligands suggested its role in regulation of monocyte chemotaxis and thymic cell apoptosis. More specifically, this receptor may contribute to the proper positioning of activated T cells within the antigenic challenge sites and specialized areas of lymphoid tissues. This gene is located at the chemokine receptor gene cluster region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two independently generated knock-out alleles show normal lung eosinophilia and Th2 cytokine responses in OVA-elicited asthma models. Mice homozygous for a third knock-out allele show a delay in onset of clinical signs of experimental autoimmune encephalomyelitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Ccr8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01511:Ccr8 APN 9 120094625 missense probably damaging 1.00
IGL02558:Ccr8 APN 9 120094658 missense probably benign 0.01
IGL02966:Ccr8 APN 9 120094140 missense probably damaging 0.96
IGL03135:Ccr8 APN 9 120094623 missense possibly damaging 0.89
R0402:Ccr8 UTSW 9 120094910 unclassified probably null
R0739:Ccr8 UTSW 9 120094349 missense probably damaging 1.00
R1069:Ccr8 UTSW 9 120094217 missense probably benign 0.00
R4766:Ccr8 UTSW 9 120094464 missense probably damaging 1.00
R4934:Ccr8 UTSW 9 120094749 missense probably benign
R5942:Ccr8 UTSW 9 120094706 missense probably damaging 0.99
R5957:Ccr8 UTSW 9 120093827 missense probably damaging 0.99
R5996:Ccr8 UTSW 9 120094463 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTCACGATGACCGACTAC -3'
(R):5'- CCTTGATGGCATAGACAGCGTG -3'

Sequencing Primer
(F):5'- GATGACCGACTACTACCCTGATTTC -3'
(R):5'- GATACCTGTCCACACTCATTAGGG -3'
Posted On2016-06-15