Incidental Mutation 'R5116:Akap6'
ID394212
Institutional Source Beutler Lab
Gene Symbol Akap6
Ensembl Gene ENSMUSG00000061603
Gene NameA kinase (PRKA) anchor protein 6
Synonyms
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.739) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location52699383-53155599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 53141515 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1904 (E1904G)
Ref Sequence ENSEMBL: ENSMUSP00000093406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095737] [ENSMUST00000219786]
Predicted Effect probably benign
Transcript: ENSMUST00000095737
AA Change: E1904G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000093406
Gene: ENSMUSG00000061603
AA Change: E1904G

DomainStartEndE-ValueType
low complexity region 34 51 N/A INTRINSIC
Blast:SPEC 66 168 2e-50 BLAST
low complexity region 441 455 N/A INTRINSIC
low complexity region 544 555 N/A INTRINSIC
low complexity region 569 587 N/A INTRINSIC
low complexity region 640 651 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
SPEC 779 880 1.06e-1 SMART
SPEC 959 1057 1.45e0 SMART
SPEC 1078 1185 2.56e-2 SMART
low complexity region 1316 1332 N/A INTRINSIC
low complexity region 1555 1568 N/A INTRINSIC
low complexity region 1610 1622 N/A INTRINSIC
low complexity region 1683 1698 N/A INTRINSIC
low complexity region 1737 1781 N/A INTRINSIC
low complexity region 1899 1910 N/A INTRINSIC
low complexity region 2019 2031 N/A INTRINSIC
low complexity region 2104 2115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219786
Meta Mutation Damage Score 0.1 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is highly expressed in various brain regions and cardiac and skeletal muscle. It is specifically localized to the sarcoplasmic reticulum and nuclear membrane, and is involved in anchoring PKA to the nuclear membrane or sarcoplasmic reticulum. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in partial embryonic lethality; surviving homozygotes display a decreased body weight, craniofacial defects and reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Akap6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Akap6 APN 12 53140980 missense possibly damaging 0.79
IGL00505:Akap6 APN 12 52887102 missense possibly damaging 0.92
IGL01134:Akap6 APN 12 52937217 missense probably damaging 0.96
IGL01458:Akap6 APN 12 52886818 nonsense probably null
IGL01589:Akap6 APN 12 53139664 missense probably damaging 1.00
IGL01592:Akap6 APN 12 53142142 missense probably damaging 1.00
IGL01738:Akap6 APN 12 52886817 missense probably damaging 0.99
IGL01867:Akap6 APN 12 52888008 missense probably damaging 1.00
IGL02025:Akap6 APN 12 53140335 missense probably benign
IGL02041:Akap6 APN 12 53140653 missense probably damaging 1.00
IGL02058:Akap6 APN 12 53140555 missense probably damaging 1.00
IGL02194:Akap6 APN 12 52886823 missense probably benign 0.00
IGL02226:Akap6 APN 12 53010467 splice site probably benign
IGL02323:Akap6 APN 12 53140429 missense probably benign 0.00
IGL02449:Akap6 APN 12 53140188 missense probably damaging 1.00
IGL02475:Akap6 APN 12 53139494 missense probably benign 0.03
IGL02546:Akap6 APN 12 52880738 missense probably damaging 1.00
IGL02547:Akap6 APN 12 53140696 missense probably damaging 1.00
IGL02588:Akap6 APN 12 52886499 nonsense probably null
IGL02608:Akap6 APN 12 53010606 missense probably benign 0.39
IGL02884:Akap6 APN 12 52886622 missense probably benign 0.00
IGL02945:Akap6 APN 12 52880837 missense probably damaging 1.00
IGL03029:Akap6 APN 12 52886412 missense probably damaging 1.00
IGL03129:Akap6 APN 12 53140306 missense probably damaging 1.00
R0133:Akap6 UTSW 12 53139471 nonsense probably null
R0166:Akap6 UTSW 12 53140924 missense probably benign 0.04
R0189:Akap6 UTSW 12 53141254 missense probably benign 0.41
R0532:Akap6 UTSW 12 52887983 missense probably benign 0.00
R0632:Akap6 UTSW 12 52937148 missense probably damaging 1.00
R0666:Akap6 UTSW 12 52911808 missense probably damaging 1.00
R0723:Akap6 UTSW 12 53141902 missense probably damaging 1.00
R0763:Akap6 UTSW 12 53142214 missense possibly damaging 0.93
R0785:Akap6 UTSW 12 52886622 missense probably benign 0.00
R0879:Akap6 UTSW 12 52880799 missense probably damaging 1.00
R0880:Akap6 UTSW 12 53139508 missense possibly damaging 0.93
R1033:Akap6 UTSW 12 53069222 missense probably damaging 0.97
R1055:Akap6 UTSW 12 52880672 nonsense probably null
R1199:Akap6 UTSW 12 52796190 missense probably damaging 1.00
R1295:Akap6 UTSW 12 52887029 missense probably damaging 1.00
R1389:Akap6 UTSW 12 53139520 missense probably benign 0.15
R1471:Akap6 UTSW 12 53141496 missense probably benign 0.05
R1483:Akap6 UTSW 12 52796087 missense probably damaging 1.00
R1512:Akap6 UTSW 12 52937154 missense probably damaging 1.00
R1648:Akap6 UTSW 12 53142006 nonsense probably null
R1791:Akap6 UTSW 12 53069125 missense probably damaging 1.00
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1888:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1891:Akap6 UTSW 12 53142175 missense possibly damaging 0.88
R1899:Akap6 UTSW 12 53141852 missense possibly damaging 0.95
R1917:Akap6 UTSW 12 53104612 missense probably benign 0.13
R1970:Akap6 UTSW 12 52938475 missense probably damaging 0.96
R1987:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R1988:Akap6 UTSW 12 53140795 missense possibly damaging 0.78
R2153:Akap6 UTSW 12 53141404 missense probably benign 0.03
R2567:Akap6 UTSW 12 52938373 missense probably damaging 1.00
R2568:Akap6 UTSW 12 52887278 missense possibly damaging 0.77
R3025:Akap6 UTSW 12 53140143 missense probably benign
R3051:Akap6 UTSW 12 52887033 missense probably damaging 1.00
R3195:Akap6 UTSW 12 53072457 nonsense probably null
R3196:Akap6 UTSW 12 53072457 nonsense probably null
R3426:Akap6 UTSW 12 52888034 missense probably damaging 1.00
R3783:Akap6 UTSW 12 52880769 missense probably damaging 1.00
R3934:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3936:Akap6 UTSW 12 53140444 missense possibly damaging 0.92
R3967:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R3970:Akap6 UTSW 12 53141453 missense probably damaging 1.00
R4042:Akap6 UTSW 12 53139379 critical splice acceptor site probably null
R4095:Akap6 UTSW 12 53139462 missense probably damaging 1.00
R4152:Akap6 UTSW 12 53140407 missense probably benign 0.45
R4231:Akap6 UTSW 12 53141038 missense probably damaging 1.00
R4232:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4233:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4234:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4235:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4236:Akap6 UTSW 12 53139671 missense probably damaging 1.00
R4475:Akap6 UTSW 12 53141643 missense probably benign 0.00
R4513:Akap6 UTSW 12 52796004 missense probably benign 0.03
R4686:Akap6 UTSW 12 52887623 frame shift probably null
R4724:Akap6 UTSW 12 52795885 missense possibly damaging 0.80
R4782:Akap6 UTSW 12 52887623 frame shift probably null
R4852:Akap6 UTSW 12 53104675 missense probably damaging 1.00
R5024:Akap6 UTSW 12 53142562 missense probably benign 0.01
R5164:Akap6 UTSW 12 53142466 missense probably benign
R5225:Akap6 UTSW 12 52886546 missense probably damaging 1.00
R5269:Akap6 UTSW 12 53139843 missense probably damaging 0.99
R5352:Akap6 UTSW 12 52796097 missense probably damaging 1.00
R5496:Akap6 UTSW 12 53140653 missense possibly damaging 0.87
R5551:Akap6 UTSW 12 52795964 missense probably damaging 1.00
R5997:Akap6 UTSW 12 52937233 critical splice donor site probably null
R6137:Akap6 UTSW 12 53140354 missense probably damaging 1.00
R6151:Akap6 UTSW 12 53025792 missense probably damaging 1.00
R6169:Akap6 UTSW 12 53142358 missense probably benign
R6307:Akap6 UTSW 12 53141568 missense possibly damaging 0.85
R6351:Akap6 UTSW 12 53142025 missense probably damaging 0.98
R6479:Akap6 UTSW 12 53141169 missense probably damaging 1.00
R6502:Akap6 UTSW 12 53140215 missense probably damaging 1.00
R6760:Akap6 UTSW 12 53139778 missense probably damaging 1.00
R6778:Akap6 UTSW 12 53025816 missense probably damaging 1.00
R6837:Akap6 UTSW 12 53141262 missense probably damaging 1.00
R6896:Akap6 UTSW 12 52887494 missense probably benign 0.06
R6917:Akap6 UTSW 12 53069168 missense probably null 0.97
R6983:Akap6 UTSW 12 52887653 missense probably damaging 1.00
R7142:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7143:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7216:Akap6 UTSW 12 53140457 missense probably benign 0.02
R7297:Akap6 UTSW 12 52887364 missense probably benign 0.02
R7356:Akap6 UTSW 12 52911864 missense probably damaging 1.00
R7378:Akap6 UTSW 12 53142574 missense probably benign 0.00
R7382:Akap6 UTSW 12 53142171 missense probably benign 0.00
R7498:Akap6 UTSW 12 53142705 nonsense probably null
R7542:Akap6 UTSW 12 53069234 missense not run
X0062:Akap6 UTSW 12 53142361 missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- ATTGCTCCATAAAACGTCTCTCTG -3'
(R):5'- AGTCCTGAGCAAGAGTTCTGG -3'

Sequencing Primer
(F):5'- ACGTCTCTCTGAAAACAATGGG -3'
(R):5'- GCAGTCACCCCTTTCAGGATG -3'
Posted On2016-06-15