Incidental Mutation 'R5116:Adamts19'
ID394222
Institutional Source Beutler Lab
Gene Symbol Adamts19
Ensembl Gene ENSMUSG00000053441
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 19
SynonymsD230034E10Rik
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location58836764-59053678 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58902994 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 417 (V417A)
Ref Sequence ENSEMBL: ENSMUSP00000050535 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052907
AA Change: V417A

PolyPhen 2 Score 0.516 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050535
Gene: ENSMUSG00000053441
AA Change: V417A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
low complexity region 57 84 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
Pfam:Pep_M12B_propep 131 276 1.6e-21 PFAM
Pfam:Reprolysin_5 326 523 1.7e-13 PFAM
Pfam:Reprolysin_4 328 544 2e-10 PFAM
Pfam:Reprolysin 328 548 9e-22 PFAM
Pfam:Reprolysin_2 346 537 1.6e-9 PFAM
Pfam:Reprolysin_3 350 496 3.4e-12 PFAM
low complexity region 551 562 N/A INTRINSIC
TSP1 639 689 5.68e-9 SMART
Pfam:ADAM_spacer1 793 903 1.1e-31 PFAM
TSP1 922 980 4.95e-2 SMART
TSP1 982 1040 4.95e-2 SMART
TSP1 1042 1086 1.62e-4 SMART
TSP1 1093 1147 1.03e-6 SMART
Pfam:PLAC 1167 1199 4.2e-9 PFAM
Meta Mutation Damage Score 0.0644 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. This gene is predominantly expressed in the ovary with lower levels of expression observed in kidney, heart, skeletal muscle, lung and testis. The encoded preproprotein undergoes proteolytic processing to generate an active protease. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pcsk5 G A 19: 17,463,434 S1264F possibly damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Adamts19
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Adamts19 APN 18 59024465 missense probably damaging 1.00
IGL00331:Adamts19 APN 18 59007325 splice site probably benign
IGL00970:Adamts19 APN 18 59011077 missense possibly damaging 0.82
IGL01328:Adamts19 APN 18 59048882 missense possibly damaging 0.89
IGL01385:Adamts19 APN 18 58972779 missense probably damaging 0.98
IGL01529:Adamts19 APN 18 58963463 missense probably damaging 0.99
IGL01535:Adamts19 APN 18 58968819 missense probably benign 0.00
IGL01557:Adamts19 APN 18 58968720 splice site probably null
IGL01705:Adamts19 APN 18 59032966 missense possibly damaging 0.91
IGL01803:Adamts19 APN 18 58952469 missense probably damaging 1.00
IGL02116:Adamts19 APN 18 58837499 missense probably benign
IGL02131:Adamts19 APN 18 59052660 missense probably damaging 1.00
IGL02312:Adamts19 APN 18 58927297 missense probably damaging 1.00
IGL02755:Adamts19 APN 18 58969933 missense probably benign 0.25
IGL02866:Adamts19 APN 18 59048842 missense possibly damaging 0.80
IGL02964:Adamts19 APN 18 58988965 missense probably damaging 1.00
IGL02982:Adamts19 APN 18 59024518 missense probably damaging 1.00
IGL03040:Adamts19 APN 18 58903008 missense probably benign 0.05
R0081:Adamts19 UTSW 18 58903065 critical splice donor site probably null
R0194:Adamts19 UTSW 18 59011148 missense probably null 1.00
R0195:Adamts19 UTSW 18 58969870 splice site probably benign
R0541:Adamts19 UTSW 18 58927300 critical splice donor site probably null
R0659:Adamts19 UTSW 18 59007493 splice site probably benign
R0967:Adamts19 UTSW 18 58972740 nonsense probably null
R1512:Adamts19 UTSW 18 59048845 missense possibly damaging 0.89
R1536:Adamts19 UTSW 18 59052615 missense probably damaging 1.00
R1582:Adamts19 UTSW 18 58969941 missense probably damaging 0.98
R1629:Adamts19 UTSW 18 58954619 missense probably damaging 0.97
R1653:Adamts19 UTSW 18 58890293 missense probably benign 0.00
R1718:Adamts19 UTSW 18 58972825 missense probably damaging 1.00
R1733:Adamts19 UTSW 18 59031929 missense probably damaging 1.00
R1753:Adamts19 UTSW 18 59007372 missense possibly damaging 0.78
R1776:Adamts19 UTSW 18 58954620 missense probably damaging 1.00
R1905:Adamts19 UTSW 18 59032945 missense possibly damaging 0.92
R1958:Adamts19 UTSW 18 58970006 missense probably benign 0.09
R1994:Adamts19 UTSW 18 58972831 critical splice donor site probably null
R2177:Adamts19 UTSW 18 58954554 missense possibly damaging 0.66
R3730:Adamts19 UTSW 18 58900910 missense probably damaging 1.00
R4342:Adamts19 UTSW 18 58942500 missense probably damaging 1.00
R4772:Adamts19 UTSW 18 58837776 missense possibly damaging 0.85
R4822:Adamts19 UTSW 18 58890284 missense probably damaging 1.00
R4891:Adamts19 UTSW 18 59033000 missense probably damaging 1.00
R5112:Adamts19 UTSW 18 59031804 nonsense probably null
R5205:Adamts19 UTSW 18 58968808 missense probably damaging 1.00
R5765:Adamts19 UTSW 18 59052582 missense probably damaging 1.00
R5781:Adamts19 UTSW 18 58837968 missense possibly damaging 0.59
R5792:Adamts19 UTSW 18 58837512 missense possibly damaging 0.49
R6082:Adamts19 UTSW 18 58968774 missense probably benign 0.18
R6088:Adamts19 UTSW 18 58902102 missense probably damaging 1.00
R7060:Adamts19 UTSW 18 58837640 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATTTGGGAGGTTGCCTTAGGA -3'
(R):5'- ACAGTAAGCCTCAGAAAGATGGA -3'

Sequencing Primer
(F):5'- AGGTTGCCTTAGGATTAATGAATTG -3'
(R):5'- GGAGAAGACTAGAATCATTATTGCC -3'
Posted On2016-06-15