Incidental Mutation 'R5116:Pcsk5'
ID394223
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 042704-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5116 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 17463434 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 1264 (S1264F)
Ref Sequence ENSEMBL: ENSMUSP00000025618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618]
Predicted Effect possibly damaging
Transcript: ENSMUST00000025618
AA Change: S1264F

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: S1264F

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Meta Mutation Damage Score 0.0972 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 95.8%
  • 20x: 90.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 T C 5: 124,078,867 H429R probably damaging Het
Adam39 G T 8: 40,825,001 C143F probably damaging Het
Adamts19 T C 18: 58,902,994 V417A possibly damaging Het
Adcy10 C A 1: 165,519,500 A362E probably damaging Het
Akap6 A G 12: 53,141,515 E1904G probably benign Het
Aldh18a1 A G 19: 40,553,505 M89T probably benign Het
Alyref G T 11: 120,597,728 F91L probably benign Het
Capn3 G T 2: 120,485,292 M248I probably benign Het
Catsper4 A T 4: 134,226,680 I56N probably damaging Het
Ccdc151 A G 9: 21,990,128 *595Q probably null Het
Cckbr T A 7: 105,433,655 I75N probably damaging Het
Ccr8 T C 9: 120,094,029 I70T probably benign Het
Cdh24 T C 14: 54,636,413 D428G probably benign Het
Cdk5rap2 G T 4: 70,307,238 Q557K possibly damaging Het
Clip1 C T 5: 123,630,707 A610T probably benign Het
Dnajc16 A T 4: 141,767,969 Y479* probably null Het
Fpr-rs3 A G 17: 20,624,300 V193A probably benign Het
Gm29125 T C 1: 80,383,973 noncoding transcript Het
Hist1h1e A G 13: 23,622,287 Y71H probably damaging Het
Ifi208 A G 1: 173,677,983 probably benign Het
Immp1l G A 2: 105,965,295 R155H probably benign Het
Itgad C A 7: 128,203,893 T7K probably damaging Het
Itgb3 T C 11: 104,641,077 V370A probably benign Het
Jak1 A G 4: 101,155,113 I1053T probably benign Het
Kif21b A G 1: 136,152,783 R572G probably damaging Het
Lama2 A T 10: 27,118,560 D1784E probably benign Het
Ltbp2 A T 12: 84,809,737 V651D probably damaging Het
Mrpl47 A G 3: 32,733,601 L100S probably damaging Het
Mx1 T G 16: 97,457,479 N6T possibly damaging Het
Nde1 T A 16: 14,183,487 M133K probably benign Het
Nlrc5 T C 8: 94,481,860 L778P probably damaging Het
Olfr1156 G A 2: 87,949,529 R235C probably benign Het
Olfr603 G A 7: 103,383,864 T46I probably benign Het
Olfr803 A G 10: 129,691,397 S215P probably damaging Het
Olfr850 A G 9: 19,477,798 S151P possibly damaging Het
Olfr885 T C 9: 38,061,338 V6A probably benign Het
Otog T C 7: 46,273,767 V1022A probably benign Het
Pcdhac1 G A 18: 37,091,447 V438M probably damaging Het
Pfas T C 11: 68,990,990 probably benign Het
Pigr T A 1: 130,849,031 F648I probably benign Het
Pla2r1 A C 2: 60,448,906 Y777D probably damaging Het
Pnpla7 G T 2: 25,021,970 G716V probably damaging Het
Rab11fip5 C T 6: 85,348,807 E206K probably damaging Het
S100a10 A G 3: 93,560,940 probably null Het
Slc35f1 T C 10: 53,021,895 I134T probably benign Het
Smarcd1 C T 15: 99,702,488 A56V probably benign Het
Snrk A G 9: 122,160,330 T247A probably benign Het
Srgap1 A G 10: 121,792,379 L896P possibly damaging Het
Tmem19 A T 10: 115,343,746 F167I probably benign Het
Tmprss11f T C 5: 86,539,696 S118G probably benign Het
Tnc A G 4: 63,967,215 probably null Het
Trem3 T C 17: 48,249,552 L17P probably benign Het
Upp2 A G 2: 58,771,542 Y67C probably damaging Het
Zfp276 A G 8: 123,264,977 probably benign Het
Zfp932 T A 5: 110,009,376 D280E probably benign Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1671:Pcsk5 UTSW 19 17454868 missense probably damaging 1.00
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGTGGCCCACAGTGATG -3'
(R):5'- TCCTCTCGATAATATGTGTGCTATC -3'

Sequencing Primer
(F):5'- TATACAAGTGCTCTGAGAGTGC -3'
(R):5'- GTGTGCTATCAGGATCAACCATGAC -3'
Posted On2016-06-15