Incidental Mutation 'R5044:Tubgcp4'
ID394234
Institutional Source Beutler Lab
Gene Symbol Tubgcp4
Ensembl Gene ENSMUSG00000027263
Gene Nametubulin, gamma complex associated protein 4
SynonymsD2Ertd435e, 4932441P04Rik
MMRRC Submission 042634-MU
Accession Numbers

Genbank: NM_153387

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121170654-121198770 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121173580 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 34 (L34P)
Ref Sequence ENSEMBL: ENSMUSP00000044049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039541] [ENSMUST00000079024] [ENSMUST00000110657] [ENSMUST00000110658] [ENSMUST00000110661] [ENSMUST00000146243] [ENSMUST00000163766] [ENSMUST00000186659]
Predicted Effect probably damaging
Transcript: ENSMUST00000039541
AA Change: L34P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044049
Gene: ENSMUSG00000027263
AA Change: L34P

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 573 2.8e-111 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079024
SMART Domains Protein: ENSMUSP00000078033
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 3e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 4.1e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110657
AA Change: L34P

PolyPhen 2 Score 0.584 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106285
Gene: ENSMUSG00000027263
AA Change: L34P

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 3.1e-115 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000110658
AA Change: L34P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106286
Gene: ENSMUSG00000027263
AA Change: L34P

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110661
SMART Domains Protein: ENSMUSP00000106289
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.4e-21 PFAM
Pfam:Myb_DNA-bind_4 399 484 7.4e-22 PFAM
low complexity region 518 532 N/A INTRINSIC
ZnF_C2H2 665 687 2.99e-4 SMART
ZnF_C2H2 693 715 2.75e-3 SMART
ZnF_C2H2 721 743 8.02e-5 SMART
ZnF_C2H2 749 771 1.13e-4 SMART
ZnF_C2H2 777 799 1.18e-2 SMART
ZnF_C2H2 805 827 1.33e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130929
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135555
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144123
Predicted Effect probably benign
Transcript: ENSMUST00000146243
SMART Domains Protein: ENSMUSP00000120997
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 118 4.23e-58 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154633
Predicted Effect probably benign
Transcript: ENSMUST00000163766
SMART Domains Protein: ENSMUSP00000125987
Gene: ENSMUSG00000050619

DomainStartEndE-ValueType
SCAN 13 125 5.83e-70 SMART
Pfam:Myb_DNA-bind_4 238 323 5.9e-21 PFAM
Pfam:Myb_DNA-bind_4 434 519 1.3e-21 PFAM
low complexity region 553 567 N/A INTRINSIC
ZnF_C2H2 700 722 2.99e-4 SMART
ZnF_C2H2 728 750 2.75e-3 SMART
ZnF_C2H2 756 778 8.02e-5 SMART
ZnF_C2H2 784 806 1.13e-4 SMART
ZnF_C2H2 812 834 1.18e-2 SMART
ZnF_C2H2 840 862 1.33e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186659
AA Change: L34P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140417
Gene: ENSMUSG00000027263
AA Change: L34P

DomainStartEndE-ValueType
Pfam:Spc97_Spc98 4 572 4.1e-115 PFAM
Meta Mutation Damage Score 0.0424 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the gamma-tubulin ring complex, which is required for microtubule nucleation. In mammalian cells, the protein localizes to centrosomes in association with gamma-tubulin. Crystal structure analysis revealed a structure composed of five helical bundles arranged around conserved hydrophobic cores. An exposed surface area located in the C-terminal domain is essential and sufficient for direct binding to gamma-tubulin. Mutations in this gene that alter microtubule organization are associated with microcephaly and chorioretinopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2015]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Unc79 T A 12: 103,112,703 V1690E probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Tubgcp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Tubgcp4 APN 2 121178701 missense probably damaging 0.99
IGL01112:Tubgcp4 APN 2 121173601 missense probably benign 0.10
IGL01149:Tubgcp4 APN 2 121184783 missense probably null 0.00
IGL01869:Tubgcp4 APN 2 121175788 missense possibly damaging 0.95
IGL01873:Tubgcp4 APN 2 121188184 critical splice donor site probably null
IGL01888:Tubgcp4 APN 2 121184747 missense probably benign 0.15
IGL03060:Tubgcp4 APN 2 121176590
IGL03333:Tubgcp4 APN 2 121196173 unclassified probably null
FR4589:Tubgcp4 UTSW 2 121175463 critical splice donor site probably benign
G5030:Tubgcp4 UTSW 2 121184334 missense probably damaging 1.00
R0482:Tubgcp4 UTSW 2 121175374 missense probably benign 0.02
R0512:Tubgcp4 UTSW 2 121175419 missense probably benign 0.06
R1433:Tubgcp4 UTSW 2 121175424 nonsense probably null
R1488:Tubgcp4 UTSW 2 121176550 missense possibly damaging 0.50
R1699:Tubgcp4 UTSW 2 121189893 nonsense probably null
R1760:Tubgcp4 UTSW 2 121189471 critical splice donor site probably null
R1935:Tubgcp4 UTSW 2 121178666 splice site probably benign
R2249:Tubgcp4 UTSW 2 121183629 missense possibly damaging 0.86
R4093:Tubgcp4 UTSW 2 121195477 missense probably benign 0.01
R4422:Tubgcp4 UTSW 2 121189401 nonsense probably null
R4433:Tubgcp4 UTSW 2 121184473 missense probably benign 0.01
R4541:Tubgcp4 UTSW 2 121195426 missense probably benign 0.01
R4670:Tubgcp4 UTSW 2 121173665 nonsense probably null
R4873:Tubgcp4 UTSW 2 121184849 intron probably benign
R4877:Tubgcp4 UTSW 2 121189862 missense probably benign
R5436:Tubgcp4 UTSW 2 121188136 missense probably damaging 1.00
R5436:Tubgcp4 UTSW 2 121194182 missense probably benign 0.01
R5566:Tubgcp4 UTSW 2 121184770 missense possibly damaging 0.61
R6110:Tubgcp4 UTSW 2 121194108 missense probably benign 0.02
R6700:Tubgcp4 UTSW 2 121189848 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- AGGAACACGACCTTGTAATTGTG -3'
(R):5'- TTCACTGCCTGATAGCACTC -3'

Sequencing Primer
(F):5'- TTGTTAACCAGAATTACCAACCCAG -3'
(R):5'- GATAGCACTCCTGCCCTGTAGAAG -3'
Posted On2016-06-15