Incidental Mutation 'R5044:Unc79'
ID394271
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
MMRRC Submission 042634-MU
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5044 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 103112703 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1690 (V1690E)
Ref Sequence ENSEMBL: ENSMUSP00000098659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]
Predicted Effect probably benign
Transcript: ENSMUST00000085079
AA Change: V1513E

PolyPhen 2 Score 0.216 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: V1513E

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101099
AA Change: V1690E

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: V1690E

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177984
Predicted Effect probably benign
Transcript: ENSMUST00000178076
AA Change: V1516E

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: V1516E

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179002
AA Change: V1709E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: V1709E

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Meta Mutation Damage Score 0.038 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,373,323 F3387I possibly damaging Het
Acacb T A 5: 114,166,027 S170R probably benign Het
Adamtsl4 A G 3: 95,681,650 probably null Het
Adgrv1 A G 13: 81,488,931 C3464R probably benign Het
Apbb1 A T 7: 105,565,682 probably benign Het
Cad A G 5: 31,055,021 T23A probably benign Het
Cdca7 A G 2: 72,483,415 R183G probably benign Het
Cdpf1 T C 15: 85,809,312 T5A probably benign Het
Cep85 T C 4: 134,156,179 D133G probably damaging Het
Chrna9 T C 5: 65,971,016 L189P probably damaging Het
Clca1 A C 3: 145,007,928 probably null Het
Cntn1 G T 15: 92,242,995 V201F probably damaging Het
Col4a3 A G 1: 82,666,546 E352G unknown Het
Ddhd2 T C 8: 25,752,137 Y237C probably damaging Het
Dnah6 A C 6: 73,037,622 F3609V probably benign Het
Epha3 T C 16: 63,602,287 K580R possibly damaging Het
Fam135b T C 15: 71,462,711 N878S probably benign Het
Fam71e2 T C 7: 4,758,661 N351D probably benign Het
Fbn1 T G 2: 125,329,102 T1938P probably damaging Het
Foxg1 T C 12: 49,385,186 V234A probably damaging Het
Glt1d1 A T 5: 127,644,414 N55I probably benign Het
Gm17641 C A 3: 68,869,474 probably benign Het
Gm7665 A G 18: 16,274,731 noncoding transcript Het
Hgf A C 5: 16,614,894 N541T probably benign Het
Hipk2 G A 6: 38,818,879 P152S probably benign Het
Jarid2 C T 13: 44,906,565 L720F probably damaging Het
Kifc5b A G 17: 26,924,787 E511G probably damaging Het
Ldlr G A 9: 21,735,242 A235T probably benign Het
Lmln A G 16: 33,074,180 D231G possibly damaging Het
Lrp1 A G 10: 127,567,495 C2070R probably damaging Het
Mbl1 A G 14: 41,158,724 T190A possibly damaging Het
Mpdz A T 4: 81,381,697 S355T probably benign Het
Muc19 C T 15: 91,888,138 noncoding transcript Het
Mycbp2 A C 14: 103,139,235 probably null Het
Naa20 T C 2: 145,915,842 S164P probably damaging Het
Nme4 A T 17: 26,093,833 probably benign Het
Npas2 A T 1: 39,347,506 R619* probably null Het
Nudt19 G A 7: 35,555,746 T20I possibly damaging Het
Olfr1224-ps1 T A 2: 89,156,939 K79* probably null Het
Olfr1447 A G 19: 12,901,001 Y260H probably damaging Het
Pitpnc1 A G 11: 107,296,228 Y90H possibly damaging Het
Rcor2 A G 19: 7,269,785 T6A probably benign Het
Rif1 T A 2: 52,109,928 S1131R probably damaging Het
Rtkn T A 6: 83,150,991 D377E probably benign Het
Rtn4rl2 T A 2: 84,872,502 N242I probably damaging Het
Sbno2 G A 10: 80,062,188 L719F probably benign Het
Scn11a G T 9: 119,819,831 D55E probably damaging Het
Setd1b T A 5: 123,151,866 I632N unknown Het
Spaca6 A G 17: 17,831,196 T45A probably benign Het
Srpk2 A T 5: 23,524,392 D416E possibly damaging Het
Sspo A T 6: 48,466,955 probably null Het
Sycp1 A T 3: 102,845,054 I804N probably benign Het
Tdp2 G A 13: 24,831,826 R32Q probably benign Het
Tgfbr3 A G 5: 107,136,929 V618A possibly damaging Het
Tmc3 C T 7: 83,609,118 P439S probably benign Het
Tnxb A T 17: 34,717,483 D2740V probably damaging Het
Tspyl4 A G 10: 34,297,937 T142A probably benign Het
Ttn T C 2: 76,880,441 probably benign Het
Tubgcp4 T C 2: 121,173,580 L34P probably damaging Het
Tubgcp6 G T 15: 89,099,545 probably benign Het
Vps4b T C 1: 106,796,418 probably null Het
Wtap A G 17: 12,967,638 S341P possibly damaging Het
Wwc1 T C 11: 35,883,345 T363A probably benign Het
Zbtb8a G A 4: 129,360,500 T67M probably damaging Het
Zfp865 T C 7: 5,034,669 probably benign Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1796:Unc79 UTSW 12 103142746 missense probably damaging 0.99
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4898:Unc79 UTSW 12 103161820 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103059500 missense probably damaging 1.00
R7124:Unc79 UTSW 12 103061393 missense probably damaging 0.99
R7144:Unc79 UTSW 12 103142626 missense probably benign 0.06
R7197:Unc79 UTSW 12 103112506 missense probably benign
R7209:Unc79 UTSW 12 103125624 missense probably benign
R7232:Unc79 UTSW 12 103134475 missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103063190 missense probably damaging 1.00
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATCTGGGCCAGAGAAACAC -3'
(R):5'- GACTTCTGAAGGAGGTCTCG -3'

Sequencing Primer
(F):5'- ATCCGACAGTGACTCTCTGGTG -3'
(R):5'- ACTTCTGAAGGAGGTCTCGTTTTTG -3'
Posted On2016-06-15