Incidental Mutation 'R5045:Olfr1124'
ID394298
Institutional Source Beutler Lab
Gene Symbol Olfr1124
Ensembl Gene ENSMUSG00000050772
Gene Nameolfactory receptor 1124
SynonymsMOR264-3, Olfr1125, GA_x6K02T2Q125-48935224-48935664, GA_x6K02T2Q125-48936945-48937901, MOR264-24
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location87430275-87436623 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87435146 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 220 (I220L)
Ref Sequence ENSEMBL: ENSMUSP00000150244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062494] [ENSMUST00000215909]
Predicted Effect probably damaging
Transcript: ENSMUST00000062494
AA Change: I220L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062513
Gene: ENSMUSG00000050772
AA Change: I220L

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 4.2e-52 PFAM
Pfam:7tm_1 47 296 2.4e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215909
AA Change: I220L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr584 G A 7: 103,086,457 G308E probably benign Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Olfr1124
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Olfr1124 APN 2 87435063 missense probably benign 0.00
IGL01655:Olfr1124 APN 2 87434885 missense probably damaging 1.00
IGL01878:Olfr1124 APN 2 87434970 missense possibly damaging 0.55
IGL02265:Olfr1124 APN 2 87435344 missense probably benign 0.00
IGL02379:Olfr1124 APN 2 87435324 missense probably benign 0.07
IGL02512:Olfr1124 APN 2 87435058 missense possibly damaging 0.59
IGL02578:Olfr1124 APN 2 87435057 missense probably damaging 0.96
R0617:Olfr1124 UTSW 2 87434661 missense probably damaging 1.00
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R1376:Olfr1124 UTSW 2 87434559 missense possibly damaging 0.62
R4993:Olfr1124 UTSW 2 87435152 missense probably benign 0.00
R6119:Olfr1124 UTSW 2 87435389 nonsense probably null
R6146:Olfr1124 UTSW 2 87435318 missense possibly damaging 0.78
R6699:Olfr1124 UTSW 2 87434816 missense probably benign
R6883:Olfr1124 UTSW 2 87435279 missense probably damaging 0.99
R6966:Olfr1124 UTSW 2 87435279 missense probably damaging 0.98
R7383:Olfr1124 UTSW 2 87435377 missense possibly damaging 0.91
Z1088:Olfr1124 UTSW 2 87435159 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCAAAAGGTGTGTTCACAACTG -3'
(R):5'- ATCTGTCTCACCTGAATGACTAC -3'

Sequencing Primer
(F):5'- GCTCCTGGATAAGTGGAATCC -3'
(R):5'- GTCTCACCTGAATGACTACTATTGG -3'
Posted On2016-06-15