Incidental Mutation 'R0448:Cyp2j6'
ID39430
Institutional Source Beutler Lab
Gene Symbol Cyp2j6
Ensembl Gene ENSMUSG00000052914
Gene Namecytochrome P450, family 2, subfamily j, polypeptide 6
Synonyms
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R0448 (G1)
Quality Score212
Status Validated
Chromosome4
Chromosomal Location96516138-96553661 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96545728 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 115 (V115A)
Ref Sequence ENSEMBL: ENSMUSP00000030303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030303]
Predicted Effect probably benign
Transcript: ENSMUST00000030303
AA Change: V115A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030303
Gene: ENSMUSG00000052914
AA Change: V115A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 44 497 6.6e-138 PFAM
Meta Mutation Damage Score 0.13 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein localizes to the endoplasmic reticulum and is thought to be the predominant enzyme responsible for epoxidation of endogenous arachidonic acid in cardiac tissue. Multiple transcript variants have been found for this gene. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Cyp2j6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Cyp2j6 APN 4 96536046 missense possibly damaging 0.78
IGL01543:Cyp2j6 APN 4 96525924 missense possibly damaging 0.78
IGL02324:Cyp2j6 APN 4 96525933 missense probably damaging 0.99
IGL02727:Cyp2j6 APN 4 96545764 missense probably benign
IGL02963:Cyp2j6 APN 4 96518184 missense probably damaging 1.00
IGL03099:Cyp2j6 APN 4 96536091 missense possibly damaging 0.65
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0109:Cyp2j6 UTSW 4 96518157 missense probably damaging 0.99
R0376:Cyp2j6 UTSW 4 96526023 missense probably damaging 0.99
R0471:Cyp2j6 UTSW 4 96531748 nonsense probably null
R0734:Cyp2j6 UTSW 4 96523844 splice site probably benign
R1497:Cyp2j6 UTSW 4 96531661 missense probably damaging 1.00
R1686:Cyp2j6 UTSW 4 96523777 missense probably benign 0.08
R2079:Cyp2j6 UTSW 4 96531725 missense possibly damaging 0.87
R2293:Cyp2j6 UTSW 4 96529433 missense possibly damaging 0.87
R2350:Cyp2j6 UTSW 4 96529408 missense probably damaging 1.00
R2971:Cyp2j6 UTSW 4 96531781 missense probably benign 0.06
R3927:Cyp2j6 UTSW 4 96553288 missense probably benign 0.15
R4020:Cyp2j6 UTSW 4 96518170 missense probably benign 0.03
R5087:Cyp2j6 UTSW 4 96531699 missense probably damaging 0.99
R5309:Cyp2j6 UTSW 4 96535556 missense probably damaging 1.00
R5861:Cyp2j6 UTSW 4 96545803 missense possibly damaging 0.81
R5882:Cyp2j6 UTSW 4 96535602 missense probably benign 0.00
R6123:Cyp2j6 UTSW 4 96518029 makesense probably null
R6180:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6181:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6182:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6185:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6186:Cyp2j6 UTSW 4 96536086 missense probably damaging 1.00
R6217:Cyp2j6 UTSW 4 96518161 missense probably damaging 1.00
R6784:Cyp2j6 UTSW 4 96535504 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- TGTAACCTCACACTTCCTAAAAGATGGC -3'
(R):5'- TCTCAGGGATGCAGTGGGTGAC -3'

Sequencing Primer
(F):5'- TCACACTTCCTAAAAGATGGCAATTC -3'
(R):5'- ACAAGGCTCTCTTCATAGTGTCAG -3'
Posted On2013-05-23