Incidental Mutation 'R5045:Olfr584'
ID394329
Institutional Source Beutler Lab
Gene Symbol Olfr584
Ensembl Gene ENSMUSG00000073959
Gene Nameolfactory receptor 584
SynonymsGA_x6K02T2PBJ9-5796876-5797820, MOR30-2
MMRRC Submission 042635-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R5045 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location103081885-103088315 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103086457 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 308 (G308E)
Ref Sequence ENSEMBL: ENSMUSP00000151043 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098210] [ENSMUST00000211036] [ENSMUST00000214215]
Predicted Effect probably benign
Transcript: ENSMUST00000098210
AA Change: G313E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095811
Gene: ENSMUSG00000073959
AA Change: G313E

DomainStartEndE-ValueType
Pfam:7tm_4 38 317 1.4e-110 PFAM
Pfam:7TM_GPCR_Srsx 42 234 2.1e-9 PFAM
Pfam:7tm_1 48 299 4.6e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211036
AA Change: G308E
Predicted Effect probably benign
Transcript: ENSMUST00000214215
AA Change: G308E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810062G17Rik T C 3: 36,476,178 probably benign Het
2210408I21Rik A G 13: 77,267,808 probably null Het
4930430A15Rik T A 2: 111,193,459 Q110L unknown Het
4930519P11Rik A T 2: 154,613,030 C136* probably null Het
4930519P11Rik G T 2: 154,613,062 probably benign Het
Adgrb3 T A 1: 25,074,779 H1189L probably damaging Het
Arhgap24 A G 5: 102,891,877 I227V possibly damaging Het
Arhgap29 C A 3: 122,002,595 N445K probably benign Het
Atp13a3 T C 16: 30,339,876 H811R probably benign Het
Cd2ap T C 17: 42,807,960 N529S probably benign Het
Cdh7 T A 1: 110,098,350 S439T probably benign Het
Ces3a G T 8: 105,050,616 probably null Het
Cftr T A 6: 18,230,081 N408K probably benign Het
Chil5 T C 3: 106,024,140 N136S possibly damaging Het
Col20a1 A G 2: 181,006,845 D933G probably damaging Het
Crh A T 3: 19,693,989 L163* probably null Het
Ctps A C 4: 120,552,878 probably null Het
Cyb5d2 A G 11: 72,795,575 V63A probably damaging Het
Cyp2d11 T A 15: 82,391,071 probably null Het
Dclk3 A T 9: 111,467,788 E133D probably damaging Het
Dhrs9 A G 2: 69,392,995 D29G probably benign Het
Disp2 G A 2: 118,792,062 E1092K probably benign Het
Enpp3 A G 10: 24,776,767 I764T probably damaging Het
Epm2aip1 C A 9: 111,273,359 R467S possibly damaging Het
Fam20a T C 11: 109,677,885 I272V probably benign Het
Fgb T C 3: 83,043,373 Y358C probably damaging Het
Gm11596 A T 11: 99,792,869 S142T unknown Het
Gm4858 G T 3: 93,074,217 D181Y probably damaging Het
Golga4 A G 9: 118,565,656 T9A probably benign Het
Hmcn2 C T 2: 31,409,081 P2813L probably damaging Het
Ighv1-9 C T 12: 114,583,820 G34R probably damaging Het
Kalrn A C 16: 34,314,352 Y353* probably null Het
Klrk1 T C 6: 129,617,503 Y42C probably benign Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Mbtd1 T C 11: 93,931,815 Y484H probably benign Het
Mki67 T C 7: 135,707,904 R273G possibly damaging Het
Myh11 A T 16: 14,239,527 L308* probably null Het
Nacc2 G A 2: 26,090,138 probably null Het
Nadsyn1 A G 7: 143,806,969 L354P probably damaging Het
Ntrk3 T A 7: 78,460,424 Q354L probably benign Het
Olfr1124 A T 2: 87,435,146 I220L probably damaging Het
Phactr3 T C 2: 178,331,619 I470T probably damaging Het
Pkd1l3 C T 8: 109,623,155 P211S unknown Het
Prickle2 T C 6: 92,376,394 D753G probably damaging Het
Prr12 A G 7: 45,049,894 probably benign Het
Psd3 T C 8: 67,713,825 E917G probably damaging Het
Rgsl1 T A 1: 153,821,522 K551* probably null Het
Stag3 T C 5: 138,304,478 L1033P probably damaging Het
Tcaf3 T A 6: 42,593,684 Q378L possibly damaging Het
Tespa1 A T 10: 130,362,035 K309* probably null Het
Trim69 A G 2: 122,174,246 T275A probably benign Het
Txndc17 T C 11: 72,207,711 Y30H probably damaging Het
Ugt2a2 A T 5: 87,474,892 F72L probably damaging Het
Vmn2r59 A T 7: 42,046,072 D305E possibly damaging Het
Vmn2r71 A G 7: 85,624,389 I804V probably benign Het
Zfy2 T C Y: 2,107,159 K492E possibly damaging Het
Zkscan1 A G 5: 138,100,920 H375R probably damaging Het
Other mutations in Olfr584
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:Olfr584 APN 7 103086375 missense probably benign 0.00
IGL02113:Olfr584 APN 7 103085850 missense possibly damaging 0.95
IGL02398:Olfr584 APN 7 103086106 missense probably damaging 1.00
IGL02718:Olfr584 APN 7 103085583 missense probably benign 0.01
IGL02941:Olfr584 APN 7 103086321 missense probably benign 0.05
IGL02942:Olfr584 APN 7 103086198 missense probably benign 0.07
R0496:Olfr584 UTSW 7 103085590 missense probably damaging 1.00
R0511:Olfr584 UTSW 7 103085851 missense probably damaging 1.00
R0646:Olfr584 UTSW 7 103086151 missense probably damaging 0.99
R1652:Olfr584 UTSW 7 103085806 missense probably benign 0.04
R2312:Olfr584 UTSW 7 103086426 missense probably damaging 0.99
R2849:Olfr584 UTSW 7 103086112 missense probably damaging 1.00
R2937:Olfr584 UTSW 7 103086341 missense probably benign 0.01
R3176:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3276:Olfr584 UTSW 7 103085750 missense probably damaging 1.00
R3708:Olfr584 UTSW 7 103086294 missense probably damaging 1.00
R4737:Olfr584 UTSW 7 103085914 missense probably damaging 1.00
R5172:Olfr584 UTSW 7 103085677 missense probably damaging 1.00
R5849:Olfr584 UTSW 7 103085521 start codon destroyed probably null 0.02
R6294:Olfr584 UTSW 7 103085667 missense probably benign 0.01
R6846:Olfr584 UTSW 7 103086058 missense possibly damaging 0.88
R6869:Olfr584 UTSW 7 103085868 missense possibly damaging 0.47
R6936:Olfr584 UTSW 7 103085814 missense probably damaging 0.97
R7133:Olfr584 UTSW 7 103085998 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACATGTGCTTCTCATATTGGTGTC -3'
(R):5'- TCTCAGATCTCTTGATATGGATACC -3'

Sequencing Primer
(F):5'- CCGAGTTGTTCACATCATG -3'
(R):5'- GATCTCTTGATATGGATACCATGAAG -3'
Posted On2016-06-15