Incidental Mutation 'R5046:Ndufc2'
ID394372
Institutional Source Beutler Lab
Gene Symbol Ndufc2
Ensembl Gene ENSMUSG00000030647
Gene NameNADH dehydrogenase (ubiquinone) 1, subcomplex unknown, 2
Synonyms1810004I06Rik, 2010300P09Rik, 14.5b subunit of the NADH-ubiquinone dehydrogenase complex, G1
MMRRC Submission 042636-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location97400003-97407802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 97407664 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 120 (R120L)
Ref Sequence ENSEMBL: ENSMUSP00000032882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032882] [ENSMUST00000149122]
Predicted Effect probably damaging
Transcript: ENSMUST00000032882
AA Change: R120L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032882
Gene: ENSMUSG00000030647
AA Change: R120L

DomainStartEndE-ValueType
Pfam:NDUF_C2 8 120 3.4e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120511
Predicted Effect probably benign
Transcript: ENSMUST00000149122
Meta Mutation Damage Score 0.432 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A C 11: 23,620,354 M182R probably benign Het
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 A658D probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Cryzl2 T C 1: 157,465,013 C122R probably damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3161P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Mtfmt G T 9: 65,439,615 V164F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1065S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L possibly damaging Het
Pign A T 1: 105,522,073 N909K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 R307W probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T401A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D117G probably benign Het
Wdr73 A T 7: 80,892,425 probably benign Het
Other mutations in Ndufc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Ndufc2 APN 7 97400190 start codon destroyed probably null 0.98
IGL01072:Ndufc2 APN 7 97400283 missense probably damaging 0.97
FR4589:Ndufc2 UTSW 7 97400290 missense probably benign
FR4976:Ndufc2 UTSW 7 97400274 missense probably damaging 0.99
R0437:Ndufc2 UTSW 7 97400337 missense probably benign 0.02
R6225:Ndufc2 UTSW 7 97406892 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACCCTGACCCTAGCC -3'
(R):5'- CTGGAGGAGCTAGGTTGCAA -3'

Sequencing Primer
(F):5'- TGTTTTGAATGCTGAAGCCTAAGCC -3'
(R):5'- TGCACAAGCCTGCATATGTG -3'
Posted On2016-06-15