Incidental Mutation 'R5046:0610010F05Rik'
List |< first << previous [record 43 of 386652] next >> last >|
ID394384
Institutional Source Beutler Lab
Gene Symbol 0610010F05Rik
Ensembl Gene ENSMUSG00000042208
Gene NameRIKEN cDNA 0610010F05 gene
Synonyms
Accession Numbers
Stock #R5046 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location23564961-23633631 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23620354 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 36 (M36R)
Ref Sequence ENSEMBL: ENSMUSP00000121553 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043356] [ENSMUST00000109532] [ENSMUST00000141353] [ENSMUST00000155903] [ENSMUST00000180260]
Predicted Effect probably benign
Transcript: ENSMUST00000043356
AA Change: M182R

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000044265
Gene: ENSMUSG00000042208
AA Change: M182R

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109532
AA Change: M182R

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105158
Gene: ENSMUSG00000042208
AA Change: M182R

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 5.1e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141353
AA Change: M36R

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000121553
Gene: ENSMUSG00000042208
AA Change: M36R

DomainStartEndE-ValueType
Pfam:DUF3342 1 189 7.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155903
AA Change: M182R

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000137799
Gene: ENSMUSG00000042208
AA Change: M182R

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 1e-106 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000180260
AA Change: M182R

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000136118
Gene: ENSMUSG00000042208
AA Change: M182R

DomainStartEndE-ValueType
low complexity region 8 16 N/A INTRINSIC
Pfam:DUF3342 147 449 4.5e-107 PFAM
low complexity region 565 576 N/A INTRINSIC
low complexity region 579 596 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (52/52)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm4 C A 7: 119,703,374 H241N probably damaging Het
Arhgap32 G A 9: 32,256,799 A693T probably damaging Het
B4galnt3 G T 6: 120,214,798 P630T probably damaging Het
BC026585 T C 1: 157,465,013 C49R probably damaging Het
Car12 G A 9: 66,746,613 E84K probably benign Het
Crocc2 T A 1: 93,205,902 S969T probably damaging Het
Crym A G 7: 120,195,444 V184A possibly damaging Het
Defb30 T C 14: 63,036,014 E49G probably benign Het
Dnah3 A G 7: 119,951,580 L3172P probably damaging Het
Dnajc5g A G 5: 31,109,692 N104S probably benign Het
Fcgr1 T G 3: 96,286,986 K195T probably damaging Het
Gal C T 19: 3,411,167 R89H probably damaging Het
Gcfc2 C T 6: 81,948,335 A577V probably benign Het
Gm5116 A C 7: 32,495,954 H106P noncoding transcript Het
Golga3 A T 5: 110,192,940 Q540L probably damaging Het
Hectd1 T C 12: 51,750,388 E2184G probably damaging Het
Hspa12a T C 19: 58,799,545 D615G probably damaging Het
Igkv14-130 A T 6: 67,791,481 Y107F probably damaging Het
Jarid2 T C 13: 44,914,362 F2069S noncoding transcript Het
Ldlr T A 9: 21,745,907 probably null Het
Lin9 T A 1: 180,669,198 V335D probably benign Het
Lrrc37a A T 11: 103,498,240 S2120T unknown Het
Lrrc9 C T 12: 72,481,496 Q891* probably null Het
Mtfmt G T 9: 65,439,615 V87F probably damaging Het
Nampt T C 12: 32,833,038 V74A probably damaging Het
Ndufc2 G T 7: 97,407,664 R120L probably damaging Het
Neo1 A T 9: 58,893,911 V1156D possibly damaging Het
Nlrp1b G A 11: 71,160,072 P1062S possibly damaging Het
Nop9 A G 14: 55,745,940 H56R possibly damaging Het
Olfr1287 A T 2: 111,449,589 T150S probably benign Het
Olfr790 A T 10: 129,501,309 M142L probably damaging Het
Paxbp1 A G 16: 91,025,163 S316P noncoding transcript Het
Pign A T 1: 105,522,073 M347K possibly damaging Het
Prex1 A G 2: 166,572,963 V304A probably benign Het
Racgap1 G A 15: 99,628,762 A70V probably damaging Het
Rap1gds1 C A 3: 138,955,420 E399* probably null Het
Rwdd4a G A 8: 47,542,802 probably null Het
Scp2 T C 4: 108,071,291 T151A probably benign Het
Sdha A G 13: 74,327,333 F526S probably damaging Het
Shroom1 T A 11: 53,464,045 L264Q probably benign Het
Snrpa1 A T 7: 66,069,187 I179F noncoding transcript Het
Sorl1 T C 9: 41,996,294 T1466A probably benign Het
Trpm2 C T 10: 77,966,018 C71Y probably damaging Het
Ugt2b34 G A 5: 86,904,387 S250L probably benign Het
Vmn2r88 A G 14: 51,413,181 D92G probably benign Het
Wdr73 A T 7: 80,892,425 V639E noncoding transcript Het
Other mutations in 0610010F05Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01133:0610010F05Rik APN 11 23595434 missense probably damaging 1.00
IGL01444:0610010F05Rik APN 11 23620225 splice donor site probably benign 0.00
IGL01522:0610010F05Rik APN 11 23582865 critical splice donor site probably null 0.00
IGL01819:0610010F05Rik APN 11 23584561 missense probably damaging 1.00
IGL02470:0610010F05Rik APN 11 23615222 missense probably damaging 1.00
IGL03046:0610010F05Rik UTSW 11 23615150 missense possibly damaging 0.77
R0139:0610010F05Rik UTSW 11 23620214 splice donor site probably benign
R0334:0610010F05Rik UTSW 11 23617129 splice donor site probably benign
R0646:0610010F05Rik UTSW 11 23575491 missense probably damaging 0.99
R1078:0610010F05Rik UTSW 11 23611762 missense possibly damaging 0.64
R1263:0610010F05Rik UTSW 11 23620278 nonsense probably null
R1353:0610010F05Rik UTSW 11 23620217 splice donor site probably benign
R1471:0610010F05Rik UTSW 11 23615222 missense probably damaging 1.00
R1568:0610010F05Rik UTSW 11 23589971 missense possibly damaging 0.90
R2163:0610010F05Rik UTSW 11 23576826 splice acceptor site probably benign
R2318:0610010F05Rik UTSW 11 23588701 missense probably damaging 1.00
R2426:0610010F05Rik UTSW 11 23576801 missense probably damaging 1.00
R4373:0610010F05Rik UTSW 11 23615265 unclassified probably null
R4688:0610010F05Rik UTSW 11 23593449 missense probably benign
R4816:0610010F05Rik UTSW 11 23615243 missense possibly damaging 0.67
R5156:0610010F05Rik UTSW 11 23593424 critical splice donor site probably null
R5249:0610010F05Rik UTSW 11 23575483 makesense probably null
R5615:0610010F05Rik UTSW 11 23606759 missense probably damaging 0.96
X0026:0610010F05Rik UTSW 11 23576767 missense probably benign 0.00
X0067:0610010F05Rik UTSW 11 23593420 splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTTTAGGCCTGAAGCAGCC -3'
(R):5'- TGTGGTCCAACTCTTCAAATCC -3'

Sequencing Primer
(F):5'- TGAAGCAGCCACCAGATG -3'
(R):5'- GTCTAACCTCCACTAAATGTCAGTG -3'
Posted OnJun 15, 2016