Incidental Mutation 'R0448:Add2'
ID39441
Institutional Source Beutler Lab
Gene Symbol Add2
Ensembl Gene ENSMUSG00000030000
Gene Nameadducin 2 (beta)
Synonyms
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.415) question?
Stock #R0448 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location86028681-86124409 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 86092919 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 140 (V140I)
Ref Sequence ENSEMBL: ENSMUSP00000145034 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032069] [ENSMUST00000203196] [ENSMUST00000203279] [ENSMUST00000203366] [ENSMUST00000203445] [ENSMUST00000203724] [ENSMUST00000203786] [ENSMUST00000204059] [ENSMUST00000205034]
Predicted Effect probably benign
Transcript: ENSMUST00000032069
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000032069
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203196
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145104
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203279
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145452
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 289 1.77e-20 SMART
coiled coil region 310 337 N/A INTRINSIC
low complexity region 439 477 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203366
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144849
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203445
AA Change: V140I

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145494
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Pfam:Aldolase_II 135 184 7.3e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203529
Predicted Effect probably benign
Transcript: ENSMUST00000203724
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145296
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203786
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000144694
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204059
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145160
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
coiled coil region 558 585 N/A INTRINSIC
low complexity region 687 725 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205034
AA Change: V140I

PolyPhen 2 Score 0.053 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000145034
Gene: ENSMUSG00000030000
AA Change: V140I

DomainStartEndE-ValueType
Aldolase_II 135 317 2.9e-48 SMART
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: This gene encodes the beta subunit of the adducin family. Adducins, encoded by alpha, beta and gamma genes, are heteromeric proteins that crosslink actin filaments with spectrin at the cytoskeletal membrane. This protein, primarily found in the brain and hematopoietic cells, is regulated by phosphorylation and calmodulin interactions as it promotes spectrin assembly onto actin filaments, bundles actin and caps barbed ends of actin filaments. In mouse, deficiency of this gene can lead to mild hemolytic anemia and impaired synaptic plasticity. Mutations of this gene in mouse serve as a pathophysiological model for hereditary spherocytosis and hereditary elliptocytosis. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display mild anemia with compensated hemolysis, marked alteration in osmotic fragility, predominant presence of elliptocytes in the blood and increased blood pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Add2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02689:Add2 APN 6 86107406 missense possibly damaging 0.94
IGL02799:Add2 UTSW 6 86106252 missense possibly damaging 0.65
R0012:Add2 UTSW 6 86098628 missense probably damaging 0.98
R0452:Add2 UTSW 6 86104629 nonsense probably null
R0834:Add2 UTSW 6 86086917 missense probably damaging 0.99
R1220:Add2 UTSW 6 86087000 missense possibly damaging 0.92
R1598:Add2 UTSW 6 86098646 missense probably benign 0.03
R1806:Add2 UTSW 6 86118657 missense probably damaging 0.96
R1837:Add2 UTSW 6 86118558 missense probably damaging 1.00
R1959:Add2 UTSW 6 86096756 missense probably damaging 1.00
R1961:Add2 UTSW 6 86096756 missense probably damaging 1.00
R2152:Add2 UTSW 6 86098598 missense probably damaging 1.00
R2309:Add2 UTSW 6 86096801 missense probably damaging 1.00
R4744:Add2 UTSW 6 86110888 missense probably damaging 1.00
R4789:Add2 UTSW 6 86118770 missense probably benign 0.04
R4896:Add2 UTSW 6 86096746 missense probably benign 0.03
R4989:Add2 UTSW 6 86110858 missense probably benign 0.10
R5004:Add2 UTSW 6 86096746 missense probably benign 0.03
R5061:Add2 UTSW 6 86087047 splice site probably null
R5068:Add2 UTSW 6 86107458 missense probably damaging 0.97
R5405:Add2 UTSW 6 86101197 missense probably benign 0.09
R5418:Add2 UTSW 6 86110912 missense probably benign 0.00
R5576:Add2 UTSW 6 86107475 critical splice donor site probably null
R5952:Add2 UTSW 6 86109746 missense probably damaging 1.00
R6011:Add2 UTSW 6 86098625 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
R6031:Add2 UTSW 6 86098673 missense probably damaging 1.00
Z1088:Add2 UTSW 6 86085965 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTCTGGCAGGTGCAAATCCTTTAC -3'
(R):5'- ACTCTCACAAAAGTTAGGCACGGC -3'

Sequencing Primer
(F):5'- TAGCATTAGTCAGTGAGATCTAGAG -3'
(R):5'- CTGGTTCCCATCCAAAGAGG -3'
Posted On2013-05-23