Incidental Mutation 'R5048:Defb10'
ID394468
Institutional Source Beutler Lab
Gene Symbol Defb10
Ensembl Gene ENSMUSG00000044743
Gene Namedefensin beta 10
SynonymsDefb7
MMRRC Submission 042638-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R5048 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location21858901-21862011 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21861871 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 44 (C44Y)
Ref Sequence ENSEMBL: ENSMUSP00000061533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054162]
Predicted Effect probably damaging
Transcript: ENSMUST00000054162
AA Change: C44Y

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061533
Gene: ENSMUSG00000044743
AA Change: C44Y

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Defensin_beta 33 68 3.4e-13 PFAM
Meta Mutation Damage Score 0.0328 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.1%
Validation Efficiency 98% (64/65)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 T C 2: 69,308,506 I144V probably benign Het
Abhd5 T C 9: 122,377,903 Y85H probably damaging Het
Acadsb G A 7: 131,437,469 G323D probably damaging Het
Amotl2 A G 9: 102,723,798 R322G probably benign Het
Aox1 A T 1: 58,059,482 probably benign Het
Aste1 C T 9: 105,396,989 R82W probably damaging Het
Atg4b T C 1: 93,775,658 I139T possibly damaging Het
Btnl5-ps T A 17: 34,488,723 noncoding transcript Het
Ccdc85c A G 12: 108,221,707 probably null Het
Clasp1 A G 1: 118,547,610 probably benign Het
Dhrs9 T C 2: 69,394,400 V144A probably damaging Het
Dnhd1 G C 7: 105,693,697 S1416T probably benign Het
Dok1 T A 6: 83,032,106 probably benign Het
Emilin2 G A 17: 71,273,967 T588M probably damaging Het
Fam181b A G 7: 93,079,939 probably benign Het
Fhad1 T C 4: 141,964,676 probably null Het
Foxi2 A G 7: 135,411,635 E198G probably damaging Het
Fsip2 C A 2: 82,993,150 A6409E probably damaging Het
Gje1 T C 10: 14,717,277 Y65C probably damaging Het
Gm38394 T C 1: 133,658,724 S292G probably damaging Het
Gm6401 T C 14: 41,967,767 probably null Het
Gprc5c T C 11: 114,870,351 *442Q probably null Het
Iars T A 13: 49,688,237 I67N probably damaging Het
Igkv4-79 T C 6: 69,042,987 S115G probably benign Het
Itga4 C A 2: 79,273,034 S156R probably benign Het
Lilra6 C T 7: 3,915,441 probably null Het
Majin C A 19: 6,222,654 A208E probably benign Het
Megf8 A G 7: 25,331,092 Q490R possibly damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mgarp G A 3: 51,391,286 R88C probably damaging Het
Msh2 T C 17: 87,672,768 F58S probably damaging Het
Nemp1 T C 10: 127,690,935 probably null Het
Nlrp10 A T 7: 108,924,565 N569K probably benign Het
Nxpe2 T C 9: 48,326,088 probably null Het
Olfr1140 C A 2: 87,746,319 A41E probably benign Het
Olfr1204 T C 2: 88,852,463 V171A possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pigb T A 9: 73,029,708 probably null Het
Pitpnb T C 5: 111,383,003 F221L possibly damaging Het
Prox2 A T 12: 85,094,341 W363R probably damaging Het
Psmg1 T A 16: 95,983,971 R139S probably benign Het
Rab11fip3 A G 17: 26,067,580 probably null Het
Samd9l G A 6: 3,374,157 R1035C probably benign Het
Shkbp1 G A 7: 27,352,096 probably benign Het
Slc30a5 C A 13: 100,806,741 L536F probably damaging Het
Slc6a17 A T 3: 107,471,437 L643* probably null Het
Slit3 T C 11: 35,588,985 Y330H probably damaging Het
St13 G C 15: 81,399,585 R4G probably benign Het
Stoml3 A C 3: 53,500,792 K86N possibly damaging Het
Tmtc1 A T 6: 148,237,846 L926Q possibly damaging Het
Tns4 T G 11: 99,078,779 R285S possibly damaging Het
Uncx C T 5: 139,547,119 T313M probably benign Het
Vmn2r75 G A 7: 86,165,527 R253C possibly damaging Het
Zfp143 A G 7: 110,074,118 T142A probably damaging Het
Zfp287 T C 11: 62,714,951 K366E probably damaging Het
Other mutations in Defb10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Defb10 APN 8 21861936 missense possibly damaging 0.93
R1442:Defb10 UTSW 8 21858928 start codon destroyed probably benign 0.08
R1502:Defb10 UTSW 8 21858956 missense possibly damaging 0.86
R5227:Defb10 UTSW 8 21861878 nonsense probably null
R6879:Defb10 UTSW 8 21861882 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCTTGGAAGAGAAAATTGTCCC -3'
(R):5'- CCTAAACCTGGACATTAGCCTTG -3'

Sequencing Primer
(F):5'- TTGGAAGAGAAAATTGTCCCATGAAC -3'
(R):5'- CACAGGTTTCAATAGGATCTGAAG -3'
Posted On2016-06-15