Incidental Mutation 'R0448:Arhgef7'
ID39449
Institutional Source Beutler Lab
Gene Symbol Arhgef7
Ensembl Gene ENSMUSG00000031511
Gene NameRho guanine nucleotide exchange factor (GEF7)
Synonymscool-1, betaPix, Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-b, betaPix-c
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.805) question?
Stock #R0448 (G1)
Quality Score87
Status Validated
Chromosome8
Chromosomal Location11727721-11835219 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11819659 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 432 (T432A)
Ref Sequence ENSEMBL: ENSMUSP00000106529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074856] [ENSMUST00000098938] [ENSMUST00000110904] [ENSMUST00000110909]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000033908
SMART Domains Protein: ENSMUSP00000033908
Gene: ENSMUSG00000031511

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
low complexity region 600 614 N/A INTRINSIC
low complexity region 630 647 N/A INTRINSIC
low complexity region 660 672 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000074856
AA Change: T501A

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000074399
Gene: ENSMUSG00000031511
AA Change: T501A

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
PDB:3L4F|C 587 646 2e-32 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000098938
AA Change: T501A

PolyPhen 2 Score 0.458 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096538
Gene: ENSMUSG00000031511
AA Change: T501A

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 443 457 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 503 515 N/A INTRINSIC
low complexity region 569 600 N/A INTRINSIC
PDB:3L4F|C 646 705 2e-32 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000110904
AA Change: T432A

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106529
Gene: ENSMUSG00000031511
AA Change: T432A

DomainStartEndE-ValueType
SH3 9 64 9.97e-26 SMART
RhoGEF 97 272 8.36e-43 SMART
PH 302 402 3.77e-9 SMART
low complexity region 428 440 N/A INTRINSIC
low complexity region 494 525 N/A INTRINSIC
PDB:3L4F|C 571 630 2e-32 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000110909
AA Change: T658A

PolyPhen 2 Score 0.386 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000106534
Gene: ENSMUSG00000031511
AA Change: T658A

DomainStartEndE-ValueType
CH 3 107 7.28e-13 SMART
Pfam:RhoGEF67_u1 117 163 8e-21 PFAM
SH3 166 221 9.97e-26 SMART
RhoGEF 254 429 8.36e-43 SMART
PH 459 559 3.77e-9 SMART
Pfam:RhoGEF67_u2 611 711 2.3e-53 PFAM
low complexity region 726 757 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211510
Meta Mutation Damage Score 0.132 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of cytoplasmic proteins that activate the Ras-like family of Rho proteins by exchanging bound GDP for GTP. It forms a complex with the small GTP binding protein Rac1 and recruits Rac1 to membrane ruffles and to focal adhesions. Multiple alternatively spliced transcript variants encoding different isoforms have been observed for this gene. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Arhgef7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01020:Arhgef7 APN 8 11782540 missense probably damaging 1.00
IGL01481:Arhgef7 APN 8 11815256 missense probably benign 0.01
IGL02376:Arhgef7 APN 8 11817735 missense probably damaging 1.00
IGL02812:Arhgef7 APN 8 11781245 unclassified probably benign
IGL02813:Arhgef7 APN 8 11800767 unclassified probably benign
IGL02864:Arhgef7 APN 8 11815247 missense possibly damaging 0.49
Mental_fitness UTSW 8 11800811 missense probably damaging 1.00
R0139:Arhgef7 UTSW 8 11800503 missense probably damaging 0.99
R0157:Arhgef7 UTSW 8 11785812 missense probably damaging 1.00
R0332:Arhgef7 UTSW 8 11824701 nonsense probably null
R0973:Arhgef7 UTSW 8 11819659 missense possibly damaging 0.78
R1491:Arhgef7 UTSW 8 11819733 critical splice donor site probably null
R1566:Arhgef7 UTSW 8 11782620 missense possibly damaging 0.85
R1601:Arhgef7 UTSW 8 11782638 unclassified probably null
R1716:Arhgef7 UTSW 8 11808713 splice site probably null
R1717:Arhgef7 UTSW 8 11808712 unclassified probably benign
R1717:Arhgef7 UTSW 8 11808713 splice site probably null
R1719:Arhgef7 UTSW 8 11808713 splice site probably null
R1901:Arhgef7 UTSW 8 11808713 splice site probably null
R1902:Arhgef7 UTSW 8 11808713 splice site probably null
R1933:Arhgef7 UTSW 8 11808713 splice site probably null
R1934:Arhgef7 UTSW 8 11808713 splice site probably null
R1956:Arhgef7 UTSW 8 11805266 missense probably damaging 1.00
R2122:Arhgef7 UTSW 8 11728256 missense possibly damaging 0.94
R2273:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2275:Arhgef7 UTSW 8 11815010 missense possibly damaging 0.94
R2306:Arhgef7 UTSW 8 11812680 nonsense probably null
R2375:Arhgef7 UTSW 8 11814995 missense probably benign 0.08
R4530:Arhgef7 UTSW 8 11800802 missense possibly damaging 0.60
R4805:Arhgef7 UTSW 8 11831552 missense probably damaging 1.00
R5204:Arhgef7 UTSW 8 11800775 nonsense probably null
R5212:Arhgef7 UTSW 8 11728388 missense probably benign 0.40
R5256:Arhgef7 UTSW 8 11800811 missense probably damaging 1.00
R5718:Arhgef7 UTSW 8 11785774 missense probably damaging 1.00
R6195:Arhgef7 UTSW 8 11822017 missense probably damaging 1.00
R6503:Arhgef7 UTSW 8 11833054 missense possibly damaging 0.58
R6679:Arhgef7 UTSW 8 11824667 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- ACGCCTTACTGCCATGTACACTG -3'
(R):5'- GCCCTGTGTGAATGAGAGGAATCTG -3'

Sequencing Primer
(F):5'- CCATGTACACTGTGGGGTC -3'
(R):5'- CAGCCGATGCAGAGACTG -3'
Posted On2013-05-23