Incidental Mutation 'R5049:Olfr71'
ID394511
Institutional Source Beutler Lab
Gene Symbol Olfr71
Ensembl Gene ENSMUSG00000046450
Gene Nameolfactory receptor 71
SynonymsGA_x6K02T2N78B-16230286-16231224, mOR17, MOR262-4
MMRRC Submission 042639-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R5049 (G1)
Quality Score174
Status Validated
Chromosome4
Chromosomal Location43704562-43710255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43706259 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 103 (L103Q)
Ref Sequence ENSEMBL: ENSMUSP00000149725 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055401] [ENSMUST00000107862] [ENSMUST00000217544]
Predicted Effect probably damaging
Transcript: ENSMUST00000055401
AA Change: L103Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000060230
Gene: ENSMUSG00000046450
AA Change: L103Q

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 2.4e-34 PFAM
Pfam:7tm_4 139 283 4.5e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107862
AA Change: L103Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103494
Gene: ENSMUSG00000046450
AA Change: L103Q

DomainStartEndE-ValueType
Pfam:7tm_4 30 307 2.2e-52 PFAM
Pfam:7tm_1 41 290 7.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217544
AA Change: L103Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.3%
  • 10x: 95.8%
  • 20x: 90.4%
Validation Efficiency 97% (89/92)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,843,209 D183E probably damaging Het
4932438A13Rik T A 3: 37,040,506 probably benign Het
4932438A13Rik T C 3: 37,041,390 M1016T probably damaging Het
9330182L06Rik A G 5: 9,428,488 T451A probably damaging Het
Aamp A G 1: 74,282,539 S76P probably damaging Het
Acot8 A G 2: 164,799,690 probably benign Het
Angptl7 A G 4: 148,498,011 F143L probably benign Het
Atxn7l1 A G 12: 33,358,687 T283A probably benign Het
Brd3 G T 2: 27,450,577 probably benign Het
C130026L21Rik T A 5: 111,581,836 noncoding transcript Het
Cbr4 T G 8: 61,495,204 probably null Het
Ccl19 A G 4: 42,756,268 probably null Het
Ccl2 G T 11: 82,036,507 C34F probably damaging Het
Dnah12 A T 14: 26,735,697 T873S probably benign Het
Dnah2 T C 11: 69,448,166 N3118S probably damaging Het
Epb41l1 C A 2: 156,524,939 P564Q possibly damaging Het
Extl3 A T 14: 65,076,032 M567K probably benign Het
Fam160b1 T C 19: 57,386,305 I704T possibly damaging Het
Fam208b A T 13: 3,574,000 H1983Q probably benign Het
Foxf2 T C 13: 31,627,175 S366P probably benign Het
Gamt T A 10: 80,258,954 T186S probably benign Het
Gcn1l1 T A 5: 115,606,671 M1642K probably damaging Het
Gm21738 T A 14: 19,415,957 Y194F probably benign Het
Golga1 A T 2: 39,047,735 M115K probably damaging Het
Herc3 A G 6: 58,894,539 probably null Het
Hes2 C A 4: 152,159,874 L39I possibly damaging Het
Hopx C A 5: 77,095,052 probably benign Het
Idi1 C T 13: 8,888,042 P175S probably damaging Het
Ifit1bl1 A T 19: 34,594,081 C325* probably null Het
Ighv7-3 T C 12: 114,153,333 I70V probably benign Het
Kcnq3 T C 15: 66,285,897 T110A probably benign Het
Kif5a T C 10: 127,239,839 D451G possibly damaging Het
Lama3 A G 18: 12,582,611 E1708G probably benign Het
Lrriq4 T A 3: 30,650,937 D371E probably damaging Het
Lyst T A 13: 13,636,064 V773E probably damaging Het
Map4 T A 9: 110,079,814 L23* probably null Het
Mapkbp1 G T 2: 120,015,501 probably benign Het
Mrpl30 A T 1: 37,897,710 D52V possibly damaging Het
Olfr1122 A T 2: 87,388,658 T318S probably benign Het
Pard3b T A 1: 62,161,161 H286Q probably benign Het
Parp4 A G 14: 56,635,731 K1144R possibly damaging Het
Pdcd11 C A 19: 47,107,115 S625R probably benign Het
Pkhd1l1 T C 15: 44,457,616 S22P probably benign Het
Prss32 A T 17: 23,859,247 E302D possibly damaging Het
Prss45 A G 9: 110,840,470 K205E probably damaging Het
Puf60 T A 15: 76,070,474 I500F probably damaging Het
Ryr3 A T 2: 112,640,171 I4623N probably damaging Het
Sh3bp5l T A 11: 58,338,124 probably benign Het
Slc3a1 T G 17: 85,032,845 Y232D probably damaging Het
Slc8a3 A G 12: 81,214,132 Y608H probably damaging Het
Socs7 G T 11: 97,378,643 R429L probably benign Het
Sorcs3 C A 19: 48,759,951 N786K possibly damaging Het
Sp4 A T 12: 118,254,472 M680K probably benign Het
Tas2r131 T C 6: 132,957,577 T90A probably damaging Het
Tbx21 T C 11: 97,114,710 H143R probably benign Het
Tg T A 15: 66,827,382 C833* probably null Het
Tmem245 A G 4: 56,925,057 S355P probably benign Het
Tmem86b G A 7: 4,628,466 P191S possibly damaging Het
Tnc A G 4: 64,017,986 C238R probably damaging Het
Tnn T A 1: 160,140,738 E361D probably benign Het
Tpp2 T C 1: 44,001,473 V298A possibly damaging Het
Trav7-6 A G 14: 53,717,079 N22S probably damaging Het
Trim75 T C 8: 64,982,439 probably null Het
Trrap T A 5: 144,826,717 I2492N probably damaging Het
Ufl1 G T 4: 25,254,773 A561E probably benign Het
Uqcc1 A G 2: 155,910,421 V86A probably damaging Het
Vmn1r184 A G 7: 26,267,368 I180V possibly damaging Het
Vmn1r185 A G 7: 26,611,495 F195S possibly damaging Het
Vmn2r4 A C 3: 64,398,598 probably null Het
Vmn2r87 T C 10: 130,472,429 T647A probably damaging Het
Vps13d A T 4: 145,086,766 H198Q probably damaging Het
Wdfy4 T C 14: 33,152,670 T154A possibly damaging Het
Xirp2 A G 2: 67,517,134 M3240V probably benign Het
Zfp101 T C 17: 33,381,898 R295G possibly damaging Het
Zfp619 G A 7: 39,535,514 V323I probably benign Het
Zfy1 A T Y: 726,004 I587N possibly damaging Het
Zswim6 C T 13: 107,726,575 noncoding transcript Het
Other mutations in Olfr71
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Olfr71 APN 4 43706172 missense probably damaging 1.00
R0597:Olfr71 UTSW 4 43706592 unclassified probably null
R0610:Olfr71 UTSW 4 43706400 missense possibly damaging 0.69
R1588:Olfr71 UTSW 4 43705923 missense probably damaging 0.98
R1619:Olfr71 UTSW 4 43706292 missense probably damaging 1.00
R1779:Olfr71 UTSW 4 43706041 missense probably damaging 1.00
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R2871:Olfr71 UTSW 4 43706458 missense probably benign 0.30
R4723:Olfr71 UTSW 4 43705785 missense probably damaging 1.00
R4891:Olfr71 UTSW 4 43706194 missense probably damaging 0.99
R5151:Olfr71 UTSW 4 43706518 missense probably damaging 0.99
R5491:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
R5521:Olfr71 UTSW 4 43705788 missense possibly damaging 0.88
R6225:Olfr71 UTSW 4 43705698 missense probably damaging 1.00
R6518:Olfr71 UTSW 4 43706334 missense probably benign 0.05
R6885:Olfr71 UTSW 4 43705723 missense possibly damaging 0.93
X0017:Olfr71 UTSW 4 43705990 missense probably damaging 1.00
X0021:Olfr71 UTSW 4 43706326 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGCCACTGACTTGAAGAGG -3'
(R):5'- GAAGGGATTTTCTGGCTACCCG -3'

Sequencing Primer
(F):5'- CTTGAAGAGGCAGAGCACCC -3'
(R):5'- GCTCAGTCATGTACCTGGTGAC -3'
Posted On2016-06-15