Incidental Mutation 'R0448:Sorl1'
ID39455
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 038648-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly essential (E-score: 0.558) question?
Stock #R0448 (G1)
Quality Score100
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 42004088 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 1282 (V1282L)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: V1282L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: V1282L

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4664:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6590:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAAGCCAGTCTCTCCCAGAAGGTG -3'
(R):5'- CCTTGGCAGAAAGAGGACTTGGTG -3'

Sequencing Primer
(F):5'- GACAACGCATCAGTGCTTCTG -3'
(R):5'- CGTGTCTATGCAGAGACAATAAAATC -3'
Posted On2013-05-23