Incidental Mutation 'R0448:Slc25a11'
ID39460
Institutional Source Beutler Lab
Gene Symbol Slc25a11
Ensembl Gene ENSMUSG00000014606
Gene Namesolute carrier family 25 (mitochondrial carrier oxoglutarate carrier), member 11
Synonyms2310022P18Rik, 2oxoc
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.635) question?
Stock #R0448 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location70644196-70647479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70645579 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 134 (N134S)
Ref Sequence ENSEMBL: ENSMUSP00000114685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000037534] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638] [ENSMUST00000141695] [ENSMUST00000152160]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
AA Change: N166S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606
AA Change: N166S

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037534
SMART Domains Protein: ENSMUSP00000036472
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:PA 53 150 1.4e-14 PFAM
transmembrane domain 172 194 N/A INTRINSIC
RING 230 271 2.65e-9 SMART
low complexity region 278 303 N/A INTRINSIC
low complexity region 332 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055184
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000108551
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
AA Change: N134S

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606
AA Change: N134S

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141537
Predicted Effect probably benign
Transcript: ENSMUST00000141695
SMART Domains Protein: ENSMUSP00000121511
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143313
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151034
Predicted Effect probably benign
Transcript: ENSMUST00000152160
SMART Domains Protein: ENSMUSP00000115057
Gene: ENSMUSG00000040746

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152276
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152458
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Meta Mutation Damage Score 0.09 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The oxoglutarate/malate carrier transports 2-oxoglutarate across the inner membranes of mitochondria in an electroneutral exchange for malate or other dicarboxylic acids (summary by Iacobazzi et al., 1992 [PubMed 1457818]).[supplied by OMIM, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brcc3 T A X: 75,450,041 L222* probably null Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Slc25a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03087:Slc25a11 APN 11 70645207 missense probably benign 0.09
IGL03348:Slc25a11 APN 11 70645344 unclassified probably benign
R1368:Slc25a11 UTSW 11 70645526 splice site probably null
R1505:Slc25a11 UTSW 11 70646824 missense probably benign
R1781:Slc25a11 UTSW 11 70644825 missense probably benign 0.44
R1970:Slc25a11 UTSW 11 70646173 missense probably benign 0.25
R2508:Slc25a11 UTSW 11 70645832 missense possibly damaging 0.95
R4397:Slc25a11 UTSW 11 70644851 missense probably benign 0.01
R4747:Slc25a11 UTSW 11 70645956 missense possibly damaging 0.95
R5177:Slc25a11 UTSW 11 70645817 missense probably damaging 1.00
R5243:Slc25a11 UTSW 11 70646098 missense probably damaging 1.00
R5296:Slc25a11 UTSW 11 70646185 missense probably damaging 0.97
R5510:Slc25a11 UTSW 11 70645535 missense probably damaging 1.00
R5662:Slc25a11 UTSW 11 70645419 nonsense probably null
R5771:Slc25a11 UTSW 11 70646190 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCTCTCACCTGAGTCCAGCAAGAAC -3'
(R):5'- GCAACTGGTGCATTTGTGGGAAC -3'

Sequencing Primer
(F):5'- GTCCAGCAAGAACTGCTTAGATTG -3'
(R):5'- GCTCTCATCAGGATGACTGCTG -3'
Posted On2013-05-23