Incidental Mutation 'R5051:Supv3l1'
ID394658
Institutional Source Beutler Lab
Gene Symbol Supv3l1
Ensembl Gene ENSMUSG00000020079
Gene Namesuppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms
MMRRC Submission 042641-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5051 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location62429209-62449738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 62443417 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 240 (I240S)
Ref Sequence ENSEMBL: ENSMUSP00000020273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020273]
Predicted Effect probably damaging
Transcript: ENSMUST00000020273
AA Change: I240S

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: I240S

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 47 56 N/A INTRINSIC
HELICc 379 475 1.44e-18 SMART
Pfam:SUV3_C 625 672 4e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162023
AA Change: I239S
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,691,986 N313K possibly damaging Het
5730522E02Rik G A 11: 25,768,990 T51I unknown Het
Alms1 C T 6: 85,627,934 Q2189* probably null Het
Ank1 A T 8: 23,119,381 D1363V probably damaging Het
Ap3d1 T G 10: 80,719,199 T431P probably damaging Het
Arnt A G 3: 95,470,337 T125A probably benign Het
Atp10a TGTCCGTC TGTC 7: 58,740,246 probably null Het
Bscl2 A T 19: 8,845,279 R195* probably null Het
Ccdc146 C T 5: 21,303,083 V656I possibly damaging Het
Ccr4 T C 9: 114,492,646 Y117C probably damaging Het
Cd55 T A 1: 130,448,348 D355V probably damaging Het
Cntn6 T A 6: 104,772,597 I259N probably damaging Het
Cspg4 A G 9: 56,885,736 I252V possibly damaging Het
Dmbt1 T C 7: 131,094,742 V895A probably benign Het
Ect2 A G 3: 27,102,486 V775A probably benign Het
Gm14486 T C 2: 30,658,877 noncoding transcript Het
Grin2b T C 6: 135,779,395 N444S possibly damaging Het
Heatr5b T C 17: 78,795,274 D1225G probably damaging Het
Il1rl2 G A 1: 40,343,094 V189I probably benign Het
Kif1a G A 1: 93,076,154 probably null Het
Ltbr T A 6: 125,312,770 T154S probably damaging Het
Mrgpra6 C T 7: 47,185,942 V244I probably benign Het
Myo15 G A 11: 60,487,425 probably null Het
Ndufs1 A G 1: 63,164,947 probably null Het
Nectin3 A T 16: 46,448,550 N496K possibly damaging Het
Nkd2 A G 13: 73,825,076 V147A probably benign Het
Nlrp3 G C 11: 59,566,199 R1013P probably benign Het
Olfr1280 T A 2: 111,316,254 Y258* probably null Het
Olfr1423 C A 19: 12,035,924 V273F possibly damaging Het
Pdk2 T C 11: 95,028,772 S263G probably benign Het
Pla2g4e T A 2: 120,174,304 I520F probably damaging Het
Plat A G 8: 22,773,672 T196A probably benign Het
Podn T A 4: 108,014,846 D400V probably benign Het
Poteg T C 8: 27,453,329 V147A possibly damaging Het
Prkar2a A G 9: 108,745,491 N315D probably benign Het
Rac2 A G 15: 78,564,934 I13T possibly damaging Het
Rangap1 A C 15: 81,710,463 D388E probably benign Het
Sp140 T A 1: 85,610,828 D95E possibly damaging Het
Sympk C T 7: 19,036,042 R215C probably benign Het
Tead4 A C 6: 128,294,299 probably benign Het
Tex10 G A 4: 48,460,019 A444V possibly damaging Het
Tgds A T 14: 118,128,227 I73K probably damaging Het
Tmem117 C A 15: 94,714,913 T110K probably damaging Het
Trim30a T A 7: 104,411,706 probably benign Het
Unc80 C T 1: 66,509,477 T636I probably damaging Het
Wisp3 A G 10: 39,155,156 F124L probably benign Het
Ybey G A 10: 76,468,339 R10W probably damaging Het
Zap70 A G 1: 36,781,451 I576V probably benign Het
Zfp64 T C 2: 168,926,384 D436G probably damaging Het
Other mutations in Supv3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Supv3l1 APN 10 62429821 missense probably damaging 1.00
R0090:Supv3l1 UTSW 10 62429706 missense probably benign 0.00
R0477:Supv3l1 UTSW 10 62430585 missense probably damaging 0.98
R0946:Supv3l1 UTSW 10 62429820 missense probably damaging 1.00
R1460:Supv3l1 UTSW 10 62443383 splice site probably benign
R1546:Supv3l1 UTSW 10 62432446 missense probably benign 0.08
R1941:Supv3l1 UTSW 10 62449612 missense probably benign
R3916:Supv3l1 UTSW 10 62449420 missense possibly damaging 0.67
R5030:Supv3l1 UTSW 10 62430615 missense probably damaging 1.00
R5040:Supv3l1 UTSW 10 62447065 missense possibly damaging 0.93
R5085:Supv3l1 UTSW 10 62435512 missense probably benign 0.00
R5288:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5359:Supv3l1 UTSW 10 62432399 missense probably damaging 0.96
R5372:Supv3l1 UTSW 10 62432357 missense probably damaging 0.99
R5384:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5385:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5527:Supv3l1 UTSW 10 62429829 missense probably damaging 1.00
R5602:Supv3l1 UTSW 10 62430592 missense possibly damaging 0.81
R5713:Supv3l1 UTSW 10 62430504 missense possibly damaging 0.91
R6150:Supv3l1 UTSW 10 62435722 missense possibly damaging 0.90
R6220:Supv3l1 UTSW 10 62439021 missense possibly damaging 0.82
R6903:Supv3l1 UTSW 10 62441237 missense probably damaging 1.00
R6941:Supv3l1 UTSW 10 62430586 missense possibly damaging 0.86
R7187:Supv3l1 UTSW 10 62435549 missense probably damaging 1.00
R7250:Supv3l1 UTSW 10 62445067 missense probably damaging 1.00
R7438:Supv3l1 UTSW 10 62430470 critical splice donor site probably null
R7439:Supv3l1 UTSW 10 62430615 missense probably damaging 0.99
R7515:Supv3l1 UTSW 10 62432311 missense not run
Predicted Primers PCR Primer
(F):5'- CATGTCAGTGCCATCACCTC -3'
(R):5'- ACTGTCTGCTAGAATGGATTATAGGG -3'

Sequencing Primer
(F):5'- GTCAGTGCCATCACCTCTCTCTC -3'
(R):5'- TTAGGTACCCAGAAGCCAG -3'
Posted On2016-06-15