Incidental Mutation 'R5053:Ndc1'
ID394733
Institutional Source Beutler Lab
Gene Symbol Ndc1
Ensembl Gene ENSMUSG00000028614
Gene NameNDC1 transmembrane nucleoporin
Synonymssks, Tmem48, 2810475A17Rik
MMRRC Submission 042643-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R5053 (G1)
Quality Score210
Status Not validated
Chromosome4
Chromosomal Location107367784-107416346 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107374218 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 119 (S119P)
Ref Sequence ENSEMBL: ENSMUSP00000137180 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030357] [ENSMUST00000125342] [ENSMUST00000139560] [ENSMUST00000149366]
Predicted Effect probably benign
Transcript: ENSMUST00000030357
Predicted Effect probably benign
Transcript: ENSMUST00000125342
Predicted Effect probably damaging
Transcript: ENSMUST00000139560
AA Change: S119P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120365
Gene: ENSMUSG00000028614
AA Change: S119P

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 20 666 1.7e-137 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149366
AA Change: S119P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137180
Gene: ENSMUSG00000028614
AA Change: S119P

DomainStartEndE-ValueType
Pfam:Ndc1_Nup 19 511 3.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.3%
  • 10x: 95.9%
  • 20x: 90.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mutations in this gene produce background sensitive growth rates and skeletal anomalies. Both females and males are sterile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acvrl1 A T 15: 101,137,369 I259F probably damaging Het
Adgrf2 A G 17: 42,710,443 S497P probably damaging Het
Adsl T C 15: 80,960,450 C180R probably damaging Het
Ahctf1 A G 1: 179,786,784 I448T possibly damaging Het
Alg9 G T 9: 50,788,172 G200W probably damaging Het
Amhr2 G A 15: 102,447,258 V213I probably damaging Het
Ankrd44 A T 1: 54,735,089 L200* probably null Het
As3mt A G 19: 46,709,054 Y87C probably damaging Het
Bcl11a C A 11: 24,164,068 F470L probably benign Het
Cacna2d2 A T 9: 107,514,864 Y468F probably damaging Het
Cep250 A G 2: 155,962,928 D71G possibly damaging Het
Clca4b T C 3: 144,911,121 T923A probably benign Het
Clec16a T C 16: 10,576,597 L273P probably damaging Het
Comtd1 T C 14: 21,847,696 D123G probably damaging Het
Cpa5 A T 6: 30,623,272 E144V probably damaging Het
Cyp2c37 G A 19: 40,001,887 S343N probably benign Het
Dennd6a C A 14: 26,608,583 T103K probably damaging Het
Ect2l A G 10: 18,140,345 L733P probably damaging Het
Erg T A 16: 95,524,534 H11L probably benign Het
Ero1lb T C 13: 12,599,906 L253P probably damaging Het
Etfbkmt T A 6: 149,147,268 L135* probably null Het
Frmd4a A T 2: 4,603,921 T867S probably damaging Het
Gm815 C T 19: 26,886,413 A18V unknown Het
Gna12 C A 5: 140,760,727 R321L probably benign Het
Herc1 A T 9: 66,470,326 K3458M possibly damaging Het
Irs1 A G 1: 82,286,922 L1191P probably benign Het
Kcp G T 6: 29,496,958 Q551K probably benign Het
Klhl11 C T 11: 100,472,200 V177M probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llcfc1 A G 6: 41,685,335 H91R possibly damaging Het
Lmnb2 A T 10: 80,904,655 M223K probably damaging Het
Mbd6 C T 10: 127,286,441 V173I probably benign Het
Mme T A 3: 63,364,849 V623E probably damaging Het
Nfs1 A C 2: 156,126,398 C383G probably damaging Het
Nphp4 A G 4: 152,544,462 probably null Het
Oca2 C A 7: 56,323,580 Q411K probably benign Het
Olfr1061 A G 2: 86,413,338 F238S probably damaging Het
Olfr1211 C A 2: 88,930,253 V21F probably benign Het
Olfr1377 G A 11: 50,985,310 G203D probably damaging Het
Olfr479 A G 7: 108,055,534 H184R probably benign Het
Olfr748 T A 14: 50,710,511 Y60* probably null Het
Pcdh7 A T 5: 57,721,601 T493S probably damaging Het
Phf20 T C 2: 156,273,862 S368P probably benign Het
Pla2g2e T G 4: 138,880,375 V22G possibly damaging Het
Plxna1 A T 6: 89,322,460 H1736Q probably damaging Het
Prlr C A 15: 10,325,385 Q215K probably benign Het
Prpf6 T C 2: 181,649,453 V687A probably benign Het
Ptprq T A 10: 107,563,202 T1951S probably damaging Het
Sec31a G T 5: 100,393,214 Q345K possibly damaging Het
Serpina3k T C 12: 104,343,214 probably null Het
Sertad3 T A 7: 27,476,522 V127E probably benign Het
Sf3b1 A T 1: 54,997,177 N912K probably benign Het
Shq1 A G 6: 100,655,259 L202P probably damaging Het
Sp8 C T 12: 118,849,604 T398M probably damaging Het
Tmem150c A T 5: 100,083,740 D125E probably benign Het
Trim3 G T 7: 105,617,761 D470E probably damaging Het
Ubap1 T A 4: 41,387,315 C88* probably null Het
Unc79 T A 12: 103,104,748 D1124E probably damaging Het
Usf3 T C 16: 44,217,187 S677P probably benign Het
Vmn1r76 T C 7: 11,930,314 probably null Het
Zfp819 C T 7: 43,617,146 T275I probably damaging Het
Zranb2 T A 3: 157,541,159 D161E probably damaging Het
Other mutations in Ndc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Ndc1 APN 4 107384780 splice site probably benign
IGL00929:Ndc1 APN 4 107389497 missense probably benign 0.23
IGL01340:Ndc1 APN 4 107374147 missense probably damaging 1.00
IGL01376:Ndc1 APN 4 107375197 missense probably damaging 1.00
IGL01954:Ndc1 APN 4 107395804 missense probably damaging 1.00
IGL02290:Ndc1 APN 4 107394995 splice site probably benign
IGL03251:Ndc1 APN 4 107380659 missense possibly damaging 0.50
R1168:Ndc1 UTSW 4 107395812 missense probably benign 0.02
R1541:Ndc1 UTSW 4 107371288 nonsense probably null
R1605:Ndc1 UTSW 4 107368096 missense probably damaging 0.96
R1612:Ndc1 UTSW 4 107395068 splice site probably benign
R1716:Ndc1 UTSW 4 107384795 missense probably damaging 1.00
R3522:Ndc1 UTSW 4 107393158 missense probably damaging 0.99
R4036:Ndc1 UTSW 4 107411072 missense probably benign 0.22
R4698:Ndc1 UTSW 4 107411137 missense probably benign 0.06
R4794:Ndc1 UTSW 4 107390222 missense probably benign 0.03
R5097:Ndc1 UTSW 4 107374161 missense probably benign 0.01
R5158:Ndc1 UTSW 4 107375165 missense probably damaging 1.00
R5217:Ndc1 UTSW 4 107389576 missense probably benign
R5579:Ndc1 UTSW 4 107380704 missense possibly damaging 0.74
R5666:Ndc1 UTSW 4 107389526 missense possibly damaging 0.52
R5855:Ndc1 UTSW 4 107383707 missense probably damaging 1.00
R6180:Ndc1 UTSW 4 107411198 missense possibly damaging 0.65
R6525:Ndc1 UTSW 4 107368107 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTGTCAAGGCCCTATCTCG -3'
(R):5'- GGTGCAACACTAGTGATCTCC -3'

Sequencing Primer
(F):5'- AAGGCCCTATCTCGATTCTCTAGG -3'
(R):5'- GTGATCTCCACGGGTCTCC -3'
Posted On2016-06-15