Incidental Mutation 'R5127:Tm4sf1'
ID394809
Institutional Source Beutler Lab
Gene Symbol Tm4sf1
Ensembl Gene ENSMUSG00000027800
Gene Nametransmembrane 4 superfamily member 1
SynonymsL6, 12A8 target antigen, L6 antigen, M3s1
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location57285611-57301988 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 57292868 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 109 (I109L)
Ref Sequence ENSEMBL: ENSMUSP00000143652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029376] [ENSMUST00000171384] [ENSMUST00000196506] [ENSMUST00000196979]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029376
AA Change: I109L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029376
Gene: ENSMUSG00000027800
AA Change: I109L

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000171384
AA Change: I109L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130999
Gene: ENSMUSG00000027800
AA Change: I109L

DomainStartEndE-ValueType
Pfam:L6_membrane 1 195 1.2e-96 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196506
AA Change: I109L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143697
Gene: ENSMUSG00000027800
AA Change: I109L

DomainStartEndE-ValueType
Pfam:L6_membrane 1 137 3.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196704
Predicted Effect possibly damaging
Transcript: ENSMUST00000196979
AA Change: I109L

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000143652
Gene: ENSMUSG00000027800
AA Change: I109L

DomainStartEndE-ValueType
Pfam:L6_membrane 1 194 6e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198030
Meta Mutation Damage Score 0.096 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is a cell surface antigen and is highly expressed in different carcinomas. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Tm4sf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02004:Tm4sf1 APN 3 57293078 missense possibly damaging 0.87
IGL03247:Tm4sf1 APN 3 57293015 missense possibly damaging 0.70
IGL02988:Tm4sf1 UTSW 3 57293116 splice site probably null
R0195:Tm4sf1 UTSW 3 57293059 missense probably damaging 1.00
R1710:Tm4sf1 UTSW 3 57292883 missense probably damaging 1.00
R4573:Tm4sf1 UTSW 3 57294785 missense possibly damaging 0.78
R4801:Tm4sf1 UTSW 3 57294679 missense probably damaging 1.00
R4802:Tm4sf1 UTSW 3 57294679 missense probably damaging 1.00
R4917:Tm4sf1 UTSW 3 57293027 missense probably damaging 1.00
R4918:Tm4sf1 UTSW 3 57293027 missense probably damaging 1.00
R5670:Tm4sf1 UTSW 3 57293087 missense probably benign 0.03
R5946:Tm4sf1 UTSW 3 57292868 missense possibly damaging 0.79
R6905:Tm4sf1 UTSW 3 57294909 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTCATGACTGCCCATCTAGC -3'
(R):5'- TGCGGCTACGAAAACTACGG -3'

Sequencing Primer
(F):5'- GCCTTACATACTGCATGATTTGG -3'
(R):5'- CTACGAAAACTACGGCAAGCGATG -3'
Posted On2016-06-21