Incidental Mutation 'R5127:Raver2'
ID394812
Institutional Source Beutler Lab
Gene Symbol Raver2
Ensembl Gene ENSMUSG00000035275
Gene Nameribonucleoprotein, PTB-binding 2
SynonymsA430091O22Rik
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location101068983-101152370 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101102985 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 221 (C221R)
Ref Sequence ENSEMBL: ENSMUSP00000102568 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038463] [ENSMUST00000106955]
Predicted Effect probably damaging
Transcript: ENSMUST00000038463
AA Change: C221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043142
Gene: ENSMUSG00000035275
AA Change: C221R

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
low complexity region 499 512 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106955
AA Change: C221R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102568
Gene: ENSMUSG00000035275
AA Change: C221R

DomainStartEndE-ValueType
low complexity region 2 29 N/A INTRINSIC
RRM 59 125 8.2e-11 SMART
RRM 132 205 1.67e-11 SMART
RRM 221 294 2.12e-4 SMART
low complexity region 362 379 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148148
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157926
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Raver2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Raver2 APN 4 101102868 missense probably damaging 1.00
IGL00778:Raver2 APN 4 101096271 missense probably benign 0.00
IGL01363:Raver2 APN 4 101120583 splice site probably benign
IGL02631:Raver2 APN 4 101096302 missense probably damaging 0.96
R0071:Raver2 UTSW 4 101120445 splice site probably benign
R0071:Raver2 UTSW 4 101120445 splice site probably benign
R0792:Raver2 UTSW 4 101102950 missense probably damaging 1.00
R1450:Raver2 UTSW 4 101136152 missense possibly damaging 0.58
R2044:Raver2 UTSW 4 101102812 missense probably damaging 1.00
R5162:Raver2 UTSW 4 101102724 missense probably damaging 1.00
R5342:Raver2 UTSW 4 101102692 missense possibly damaging 0.47
R5557:Raver2 UTSW 4 101136139 missense probably benign 0.04
R6190:Raver2 UTSW 4 101133617 missense probably benign 0.00
R6248:Raver2 UTSW 4 101134123 intron probably null
R6449:Raver2 UTSW 4 101133672 missense probably benign 0.41
R6640:Raver2 UTSW 4 101131303 missense probably damaging 0.98
R6852:Raver2 UTSW 4 101133590 missense probably benign 0.00
R7196:Raver2 UTSW 4 101102859 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAAGTTACTGGCCACTCC -3'
(R):5'- AGTCCTCATTACAGAGCAGAGC -3'

Sequencing Primer
(F):5'- ACTCCAAAGGCTACGGGTTTG -3'
(R):5'- TGCCACTGTGACCTGGATAAGAC -3'
Posted On2016-06-21