Incidental Mutation 'R5127:Hpse'
ID394815
Institutional Source Beutler Lab
Gene Symbol Hpse
Ensembl Gene ENSMUSG00000035273
Gene Nameheparanase
SynonymsHpa
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location100679484-100719716 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 100719537 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 20 (A20S)
Ref Sequence ENSEMBL: ENSMUSP00000108529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045617] [ENSMUST00000112908]
Predicted Effect unknown
Transcript: ENSMUST00000045617
AA Change: A20S
SMART Domains Protein: ENSMUSP00000044072
Gene: ENSMUSG00000035273
AA Change: A20S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 132 362 1.8e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000112908
AA Change: A20S
SMART Domains Protein: ENSMUSP00000108529
Gene: ENSMUSG00000035273
AA Change: A20S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Glyco_hydro_79n 144 362 1.2e-24 PFAM
Meta Mutation Damage Score 0.008 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: This gene encodes an endoglucuronidase enzyme that plays an important role in tumor invasion and metastasis. The encoded preproprotein undergoes proteolytic processing to generate an active heterodimeric enzyme that cleaves the heparan sulfate proteoglycans associated with the cell surface and extracellular matrix. Mice lacking the encoded protein do not show any prominent pathological alterations under normal conditions but fail to develop albuminuria and renal damage in response to drug-induced diabetes. [provided by RefSeq, Aug 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit precocious mammry gland development, increased angiogenesis and increased neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Hpse
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Hpse APN 5 100691330 missense possibly damaging 0.89
IGL00743:Hpse APN 5 100698999 missense probably benign 0.01
IGL02377:Hpse APN 5 100691333 missense probably damaging 1.00
R0082:Hpse UTSW 5 100692262 missense possibly damaging 0.93
R0194:Hpse UTSW 5 100719512 missense probably benign
R1974:Hpse UTSW 5 100692238 missense probably damaging 1.00
R2065:Hpse UTSW 5 100698931 missense probably damaging 1.00
R2152:Hpse UTSW 5 100691403 nonsense probably null
R2405:Hpse UTSW 5 100708771 missense possibly damaging 0.78
R3791:Hpse UTSW 5 100692238 missense probably damaging 1.00
R5147:Hpse UTSW 5 100719509 missense probably benign 0.00
R5385:Hpse UTSW 5 100708724 nonsense probably null
R6446:Hpse UTSW 5 100695569 nonsense probably null
R7009:Hpse UTSW 5 100692279 missense probably benign 0.01
R7186:Hpse UTSW 5 100695529 missense not run
X0022:Hpse UTSW 5 100691378 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCGCGAGTGTGATTGGACAG -3'
(R):5'- TTCAAAAGTGGACGTGACCGC -3'

Sequencing Primer
(F):5'- TGTGATTGGACAGGCGAGG -3'
(R):5'- AGGGATGGAGCGCTGTG -3'
Posted On2016-06-21