Incidental Mutation 'R5127:Lpcat2'
ID394819
Institutional Source Beutler Lab
Gene Symbol Lpcat2
Ensembl Gene ENSMUSG00000033192
Gene Namelysophosphatidylcholine acyltransferase 2
SynonymslysoPAFAT/LPCAT2, LPCAT2, Aytl1a, Aytl1
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location92855339-92919279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92909191 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 407 (N407I)
Ref Sequence ENSEMBL: ENSMUSP00000049252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046290] [ENSMUST00000209265] [ENSMUST00000210099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046290
AA Change: N407I

PolyPhen 2 Score 0.652 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049252
Gene: ENSMUSG00000033192
AA Change: N407I

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 35 45 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
PlsC 140 251 2.78e-22 SMART
Blast:PlsC 284 326 3e-19 BLAST
EFh 395 423 4.49e-4 SMART
EFh 432 460 6.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000116963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151106
Predicted Effect probably benign
Transcript: ENSMUST00000209265
Predicted Effect probably benign
Transcript: ENSMUST00000210099
AA Change: N367I

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
Meta Mutation Damage Score 0.0668 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Lpcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lpcat2 APN 8 92909206 missense probably damaging 1.00
IGL00823:Lpcat2 APN 8 92864970 missense possibly damaging 0.90
IGL00911:Lpcat2 APN 8 92890710 missense probably damaging 0.99
IGL01449:Lpcat2 APN 8 92871147 missense possibly damaging 0.69
IGL01951:Lpcat2 APN 8 92918047 missense probably damaging 1.00
IGL02041:Lpcat2 APN 8 92918181 missense probably benign 0.04
IGL02491:Lpcat2 APN 8 92874251 missense probably damaging 1.00
IGL02957:Lpcat2 APN 8 92875584 nonsense probably null
R0960:Lpcat2 UTSW 8 92869710 missense probably benign
R1236:Lpcat2 UTSW 8 92886569 missense probably damaging 1.00
R1422:Lpcat2 UTSW 8 92879417 missense probably damaging 1.00
R1677:Lpcat2 UTSW 8 92864932 missense probably benign 0.08
R2048:Lpcat2 UTSW 8 92869843 missense possibly damaging 0.94
R3712:Lpcat2 UTSW 8 92918170 missense possibly damaging 0.70
R3919:Lpcat2 UTSW 8 92914274 missense probably damaging 0.99
R3951:Lpcat2 UTSW 8 92864903 missense probably benign
R4357:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4358:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4359:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4401:Lpcat2 UTSW 8 92873055 missense possibly damaging 0.61
R4584:Lpcat2 UTSW 8 92889371 missense probably damaging 1.00
R5089:Lpcat2 UTSW 8 92879443 missense probably damaging 1.00
R5185:Lpcat2 UTSW 8 92869737 missense probably benign 0.04
R6380:Lpcat2 UTSW 8 92886581 missense probably benign
R6974:Lpcat2 UTSW 8 92873079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACATGTTCTGCCTCCTGAACTG -3'
(R):5'- GCAGATCTGTAAACTCGGGG -3'

Sequencing Primer
(F):5'- TGCCTCCTGAACTGGGAGTG -3'
(R):5'- TCTGTAAACTCGGGGGACAGATTC -3'
Posted On2016-06-21