Incidental Mutation 'R5127:Reps1'
ID394823
Institutional Source Beutler Lab
Gene Symbol Reps1
Ensembl Gene ENSMUSG00000019854
Gene NameRalBP1 associated Eps domain containing protein
Synonyms
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.578) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location18055861-18125155 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 18093880 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 244 (T244A)
Ref Sequence ENSEMBL: ENSMUSP00000130501 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126390] [ENSMUST00000154718] [ENSMUST00000155284] [ENSMUST00000164556] [ENSMUST00000216413]
Predicted Effect probably benign
Transcript: ENSMUST00000126390
AA Change: T244A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000123238
Gene: ENSMUSG00000019854
AA Change: T244A

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 545 561 N/A INTRINSIC
low complexity region 574 599 N/A INTRINSIC
Blast:MYSc 613 671 1e-15 BLAST
coiled coil region 750 790 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128711
Predicted Effect unknown
Transcript: ENSMUST00000150029
AA Change: T230A
SMART Domains Protein: ENSMUSP00000119651
Gene: ENSMUSG00000019854
AA Change: T230A

DomainStartEndE-ValueType
Blast:EH 2 86 5e-51 BLAST
low complexity region 143 162 N/A INTRINSIC
low complexity region 192 203 N/A INTRINSIC
low complexity region 241 252 N/A INTRINSIC
EH 265 360 2.18e-34 SMART
low complexity region 377 393 N/A INTRINSIC
low complexity region 505 521 N/A INTRINSIC
low complexity region 534 559 N/A INTRINSIC
Blast:MYSc 573 631 1e-15 BLAST
coiled coil region 709 749 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154718
AA Change: T244A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119358
Gene: ENSMUSG00000019854
AA Change: T244A

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 484 509 N/A INTRINSIC
Blast:MYSc 523 581 9e-16 BLAST
coiled coil region 660 700 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155284
SMART Domains Protein: ENSMUSP00000119629
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
Blast:EH 3 99 6e-65 BLAST
low complexity region 156 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155892
SMART Domains Protein: ENSMUSP00000117431
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
EH 2 82 9.44e-21 SMART
low complexity region 99 115 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155959
SMART Domains Protein: ENSMUSP00000114387
Gene: ENSMUSG00000019854

DomainStartEndE-ValueType
low complexity region 1 17 N/A INTRINSIC
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
EH 99 194 2.18e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164556
AA Change: T244A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000130501
Gene: ENSMUSG00000019854
AA Change: T244A

DomainStartEndE-ValueType
EH 3 99 2.34e-2 SMART
low complexity region 156 175 N/A INTRINSIC
low complexity region 205 216 N/A INTRINSIC
low complexity region 254 265 N/A INTRINSIC
EH 278 373 2.18e-34 SMART
low complexity region 390 406 N/A INTRINSIC
low complexity region 518 534 N/A INTRINSIC
low complexity region 547 572 N/A INTRINSIC
Blast:MYSc 586 644 9e-16 BLAST
coiled coil region 723 763 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000216413
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a signaling adaptor protein with two EH domains that interacts with proteins that participate in signaling, endocytosis and cytoskeletal changes. The encoded protein has been found in association with intersectin 1 and Src homology 3-domain growth factor receptor-bound 2-like (endophilin) interacting protein 1 when intersectin 1 was isolated from clathrin-coated pits. The encoded protein has also been shown to interact with amphiphysin, a cytoplasmic protein at the surface of synaptic vesicles. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Reps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01019:Reps1 APN 10 18124895 missense probably damaging 1.00
IGL01161:Reps1 APN 10 18093895 missense probably damaging 1.00
IGL01606:Reps1 APN 10 18107687 missense probably damaging 1.00
IGL01937:Reps1 APN 10 18093836 missense probably benign 0.04
IGL01945:Reps1 APN 10 18093836 missense probably benign 0.04
IGL02208:Reps1 APN 10 18119022 missense probably damaging 1.00
IGL02335:Reps1 APN 10 18056117 critical splice donor site probably null
IGL02706:Reps1 APN 10 18123015 splice site probably benign
IGL02747:Reps1 APN 10 18123600 missense probably damaging 1.00
R0554:Reps1 UTSW 10 18123119 missense possibly damaging 0.71
R0628:Reps1 UTSW 10 18121093 missense probably damaging 1.00
R1074:Reps1 UTSW 10 18094446 missense probably benign 0.01
R1710:Reps1 UTSW 10 18118950 missense possibly damaging 0.75
R1829:Reps1 UTSW 10 18107714 missense probably damaging 1.00
R2116:Reps1 UTSW 10 18124920 missense probably damaging 1.00
R2146:Reps1 UTSW 10 18093313 missense probably benign
R2161:Reps1 UTSW 10 18096283 missense probably damaging 0.99
R3704:Reps1 UTSW 10 18107680 missense probably damaging 1.00
R4115:Reps1 UTSW 10 18104207 missense possibly damaging 0.93
R4654:Reps1 UTSW 10 18114400 missense probably damaging 1.00
R4856:Reps1 UTSW 10 18123625 missense probably damaging 1.00
R4910:Reps1 UTSW 10 18107688 missense probably damaging 1.00
R5521:Reps1 UTSW 10 18104234 missense probably damaging 1.00
R5707:Reps1 UTSW 10 18056010 missense probably benign 0.06
R5724:Reps1 UTSW 10 18114483 missense possibly damaging 0.75
R6564:Reps1 UTSW 10 18122392 intron probably null
R6996:Reps1 UTSW 10 18093855 missense probably damaging 1.00
R7026:Reps1 UTSW 10 18107689 missense probably damaging 1.00
X0062:Reps1 UTSW 10 18104226 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACATGTCAGTGCACTGCAATCG -3'
(R):5'- ATAGTAGAACATTCCGCGGG -3'

Sequencing Primer
(F):5'- AGTCAGTATGCTCCTCCA -3'
(R):5'- TCCGCGGGTAACAGACGTTTAG -3'
Posted On2016-06-21