Incidental Mutation 'R5127:Kcnh5'
ID394831
Institutional Source Beutler Lab
Gene Symbol Kcnh5
Ensembl Gene ENSMUSG00000034402
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 5
Synonyms
MMRRC Submission 042715-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location74897220-75177332 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74898084 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 797 (V797A)
Ref Sequence ENSEMBL: ENSMUSP00000046864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042299]
Predicted Effect probably benign
Transcript: ENSMUST00000042299
AA Change: V797A

PolyPhen 2 Score 0.166 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000046864
Gene: ENSMUSG00000034402
AA Change: V797A

DomainStartEndE-ValueType
PAS 14 86 8.97e0 SMART
PAC 92 134 6.64e-7 SMART
Pfam:Ion_trans 214 479 1.2e-37 PFAM
Pfam:Ion_trans_2 390 473 5e-14 PFAM
cNMP 550 668 2.48e-15 SMART
low complexity region 710 717 N/A INTRINSIC
coiled coil region 907 944 N/A INTRINSIC
low complexity region 953 968 N/A INTRINSIC
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of voltage-gated potassium channels. Members of this family have diverse functions, including regulating neurotransmitter and hormone release, cardiac function, and cell volume. This protein is an outward-rectifying, noninactivating channel. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted gene disruption display thigmotaxis and abnormal startle reflex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Kcnh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Kcnh5 APN 12 74897796 missense probably benign 0.00
IGL00675:Kcnh5 APN 12 75114189 critical splice donor site probably null
IGL00688:Kcnh5 APN 12 74898397 missense probably benign 0.01
IGL00721:Kcnh5 APN 12 75007676 missense probably benign 0.32
IGL00793:Kcnh5 APN 12 75114346 missense probably damaging 0.99
IGL00802:Kcnh5 APN 12 75007625 missense possibly damaging 0.62
IGL00920:Kcnh5 APN 12 74976493 missense probably damaging 1.00
IGL01595:Kcnh5 APN 12 74898327 missense probably benign 0.05
IGL01642:Kcnh5 APN 12 74965169 missense probably damaging 0.98
IGL01675:Kcnh5 APN 12 75114500 nonsense probably null
IGL01733:Kcnh5 APN 12 74965192 missense probably benign 0.02
IGL02006:Kcnh5 APN 12 74897548 missense probably damaging 0.99
IGL02075:Kcnh5 APN 12 75087605 missense probably benign 0.00
IGL02148:Kcnh5 APN 12 74897652 missense possibly damaging 0.86
IGL02155:Kcnh5 APN 12 75176538 utr 5 prime probably benign
IGL02304:Kcnh5 APN 12 74976697 missense probably benign 0.01
IGL02957:Kcnh5 APN 12 75007665 missense probably benign 0.01
R0305:Kcnh5 UTSW 12 75114397 missense probably benign 0.00
R0470:Kcnh5 UTSW 12 75114414 missense probably benign 0.22
R0553:Kcnh5 UTSW 12 75137673 missense probably benign 0.00
R0557:Kcnh5 UTSW 12 75114549 missense probably damaging 1.00
R0590:Kcnh5 UTSW 12 74965261 missense probably damaging 1.00
R0697:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R0699:Kcnh5 UTSW 12 74976531 missense possibly damaging 0.80
R1512:Kcnh5 UTSW 12 75119937 missense probably benign
R1728:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1739:Kcnh5 UTSW 12 75114229 missense probably damaging 1.00
R1784:Kcnh5 UTSW 12 75137691 missense probably benign 0.18
R1956:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R1957:Kcnh5 UTSW 12 74897584 missense probably benign 0.01
R2155:Kcnh5 UTSW 12 74898456 critical splice acceptor site probably null
R2185:Kcnh5 UTSW 12 75130931 missense possibly damaging 0.95
R2237:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2239:Kcnh5 UTSW 12 75007719 missense probably benign 0.00
R2483:Kcnh5 UTSW 12 75114471 missense probably damaging 1.00
R2655:Kcnh5 UTSW 12 75114540 missense probably damaging 1.00
R3767:Kcnh5 UTSW 12 75087576 missense possibly damaging 0.81
R3835:Kcnh5 UTSW 12 74898270 missense probably benign
R4681:Kcnh5 UTSW 12 75007623 missense probably benign 0.00
R4728:Kcnh5 UTSW 12 75007781 missense probably damaging 1.00
R4965:Kcnh5 UTSW 12 74965151 missense probably benign 0.11
R5267:Kcnh5 UTSW 12 75087416 missense probably damaging 0.98
R5535:Kcnh5 UTSW 12 75130907 missense possibly damaging 0.76
R5590:Kcnh5 UTSW 12 74976689 missense probably benign 0.05
R5684:Kcnh5 UTSW 12 75137649 missense probably damaging 1.00
R5747:Kcnh5 UTSW 12 74898420 missense probably benign 0.04
R6123:Kcnh5 UTSW 12 75087591 missense probably benign 0.01
R6545:Kcnh5 UTSW 12 75007658 missense probably damaging 1.00
R6662:Kcnh5 UTSW 12 75007611 missense probably damaging 1.00
R7117:Kcnh5 UTSW 12 75114445 missense possibly damaging 0.87
R7161:Kcnh5 UTSW 12 74897709 missense probably benign 0.10
Z1088:Kcnh5 UTSW 12 74897761 missense probably benign 0.00
Z1088:Kcnh5 UTSW 12 74965295 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGGGTTCTTGGTCACACTG -3'
(R):5'- GCACAGAGTGATCCTGAGAG -3'

Sequencing Primer
(F):5'- GGTCACACTGTTCTCTGAGTCACTG -3'
(R):5'- CAGCTTCAGGTAGAGAGCCG -3'
Posted On2016-06-21