Incidental Mutation 'R5127:Cts8'
ID394833
Institutional Source Beutler Lab
Gene Symbol Cts8
Ensembl Gene ENSMUSG00000057446
Gene Namecathepsin 8
SynonymsCTS2, Epcs68, Epcs70
MMRRC Submission 042715-MU
Accession Numbers

Genbank: NM_019541; MGI: 1860275

Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location61246745-61255358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61253335 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 126 (V126M)
Ref Sequence ENSEMBL: ENSMUSP00000021891 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021891] [ENSMUST00000223988]
Predicted Effect probably damaging
Transcript: ENSMUST00000021891
AA Change: V126M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021891
Gene: ENSMUSG00000057446
AA Change: V126M

DomainStartEndE-ValueType
Inhibitor_I29 29 88 1.92e-21 SMART
Pept_C1 114 332 2.28e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223988
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Pknox1 C T 17: 31,590,739 P106S probably benign Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Cts8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00840:Cts8 APN 13 61251578 missense probably damaging 1.00
IGL01343:Cts8 APN 13 61249196 splice site probably benign
IGL01681:Cts8 APN 13 61253619 missense probably benign 0.01
IGL02264:Cts8 APN 13 61250958 missense probably damaging 1.00
IGL02686:Cts8 APN 13 61250970 missense probably benign 0.09
IGL03196:Cts8 APN 13 61253458 missense probably benign 0.05
R0123:Cts8 UTSW 13 61253577 missense probably benign 0.01
R0630:Cts8 UTSW 13 61253442 missense possibly damaging 0.71
R0856:Cts8 UTSW 13 61250916 missense probably damaging 1.00
R0908:Cts8 UTSW 13 61250916 missense probably damaging 1.00
R1932:Cts8 UTSW 13 61253615 missense probably damaging 0.98
R2186:Cts8 UTSW 13 61251731 missense probably damaging 1.00
R3103:Cts8 UTSW 13 61250958 missense probably damaging 1.00
R3772:Cts8 UTSW 13 61250901 splice site probably benign
R5432:Cts8 UTSW 13 61251012 missense probably benign 0.00
R6088:Cts8 UTSW 13 61253966 missense probably benign 0.01
R6298:Cts8 UTSW 13 61249223 missense possibly damaging 0.77
R6501:Cts8 UTSW 13 61250942 missense probably damaging 1.00
X0062:Cts8 UTSW 13 61251008 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CACTCTGTGAGAAGGTGACC -3'
(R):5'- GAGTTTGACATAGACTGCATCAC -3'

Sequencing Primer
(F):5'- CTCTGTGAGAAGGTGACCAGAAAG -3'
(R):5'- GACTGATATTCCAGTCCCA -3'
Posted On2016-06-21