Incidental Mutation 'R5127:Pknox1'
ID394839
Institutional Source Beutler Lab
Gene Symbol Pknox1
Ensembl Gene ENSMUSG00000006705
Gene NamePbx/knotted 1 homeobox
SynonymsD17Wsu76e, PREP1
MMRRC Submission 042715-MU
Accession Numbers

Genbank: NM_016670; MGI: 1201409

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5127 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location31564749-31607684 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 31590739 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 106 (P106S)
Ref Sequence ENSEMBL: ENSMUSP00000135804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097352] [ENSMUST00000175806] [ENSMUST00000176701]
Predicted Effect probably benign
Transcript: ENSMUST00000097352
AA Change: P106S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000094966
Gene: ENSMUSG00000006705
AA Change: P106S

DomainStartEndE-ValueType
Pfam:Meis_PKNOX_N 80 165 1.7e-39 PFAM
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175709
Predicted Effect probably benign
Transcript: ENSMUST00000175806
AA Change: P106S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000134852
Gene: ENSMUSG00000006705
AA Change: P106S

DomainStartEndE-ValueType
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175812
Predicted Effect probably benign
Transcript: ENSMUST00000176701
AA Change: P106S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000135804
Gene: ENSMUSG00000006705
AA Change: P106S

DomainStartEndE-ValueType
low complexity region 208 227 N/A INTRINSIC
low complexity region 236 252 N/A INTRINSIC
HOX 259 324 9.8e-12 SMART
low complexity region 404 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176895
Meta Mutation Damage Score 0.264 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.2%
Validation Efficiency 93% (42/45)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality during fetal growth and development with variable penetrance, decreased body weight, and impaired T cell development. [provided by MGI curators]
Allele List at MGI

All alleles(80) : Targeted, knock-out(1) Gene trapped(79)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T C 10: 79,066,992 K497E probably damaging Het
4933413J09Rik A G 14: 26,376,307 noncoding transcript Het
Aox1 A T 1: 58,030,026 I4F probably benign Het
Arhgef5 A T 6: 43,273,214 N300Y probably damaging Het
B530045E10Rik A G 10: 99,422,121 noncoding transcript Het
Ccnb1 C G 13: 100,781,775 Q121H possibly damaging Het
Cdh20 A G 1: 104,947,348 E285G probably damaging Het
Cfap54 A T 10: 92,886,387 probably null Het
Col6a3 A G 1: 90,768,345 C2667R unknown Het
Cts8 C T 13: 61,253,335 V126M probably damaging Het
Dag1 A T 9: 108,207,572 I790N possibly damaging Het
Ddit4 A G 10: 59,950,669 I186T probably damaging Het
Dnajc11 T A 4: 151,969,814 probably benign Het
Farsa A G 8: 84,868,964 D495G probably benign Het
Gm10125 T C 18: 5,567,390 noncoding transcript Het
Gm1527 T A 3: 28,903,418 I157N probably damaging Het
Gm5773 T A 3: 93,773,428 W136R probably benign Het
Hpse C A 5: 100,719,537 A20S unknown Het
Igfn1 A G 1: 135,959,896 Y2477H probably damaging Het
Kcnh5 A G 12: 74,898,084 V797A probably benign Het
Kptn T A 7: 16,125,785 C311* probably null Het
Lpcat2 A T 8: 92,909,191 N407I possibly damaging Het
Lrp1 T A 10: 127,539,634 probably benign Het
Ovol2 C T 2: 144,317,860 C120Y probably damaging Het
Pcdhac2 G T 18: 37,144,299 E111* probably null Het
Plet1 C T 9: 50,504,295 T155I probably benign Het
Ppfia2 A G 10: 106,835,760 K444R probably damaging Het
Prrc2c A T 1: 162,697,846 I397N unknown Het
Ranbp1 A G 16: 18,247,287 probably null Het
Raver2 T C 4: 101,102,985 C221R probably damaging Het
Reps1 A G 10: 18,093,880 T244A probably benign Het
Slc22a16 G A 10: 40,573,957 V130I probably benign Het
Stmnd1 G A 13: 46,299,595 S249N probably benign Het
Styx A G 14: 45,373,504 probably null Het
Sult1b1 T G 5: 87,521,548 N147T probably damaging Het
Tbc1d2 G A 4: 46,633,639 probably benign Het
Tm4sf1 T G 3: 57,292,868 I109L possibly damaging Het
Ufl1 T C 4: 25,256,010 E423G probably benign Het
Unc13c T C 9: 73,933,372 I66V probably benign Het
Wfdc10 C T 2: 164,657,140 Q57* probably null Het
Zfp369 A T 13: 65,279,033 probably benign Het
Other mutations in Pknox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Pknox1 APN 17 31599645 critical splice donor site probably null
IGL01830:Pknox1 APN 17 31595310 missense probably benign 0.21
IGL02070:Pknox1 APN 17 31603365 splice site probably benign
IGL02309:Pknox1 APN 17 31590709 missense probably benign 0.34
IGL02707:Pknox1 APN 17 31602819 missense possibly damaging 0.84
3-1:Pknox1 UTSW 17 31588462 missense probably benign 0.02
R0001:Pknox1 UTSW 17 31599636 missense probably damaging 0.98
R0147:Pknox1 UTSW 17 31604790 missense probably benign 0.01
R0148:Pknox1 UTSW 17 31604790 missense probably benign 0.01
R0388:Pknox1 UTSW 17 31603192 missense probably damaging 1.00
R0443:Pknox1 UTSW 17 31592219 missense probably damaging 1.00
R0920:Pknox1 UTSW 17 31596891 missense probably damaging 0.99
R1428:Pknox1 UTSW 17 31592092 splice site probably benign
R1563:Pknox1 UTSW 17 31595282 missense probably damaging 1.00
R4199:Pknox1 UTSW 17 31602816 missense probably damaging 0.96
R4200:Pknox1 UTSW 17 31599610 missense probably benign 0.04
R4665:Pknox1 UTSW 17 31595326 critical splice donor site probably null
R4700:Pknox1 UTSW 17 31603312 missense probably damaging 1.00
R4764:Pknox1 UTSW 17 31590713 missense possibly damaging 0.92
R6220:Pknox1 UTSW 17 31603203 nonsense probably null
R6712:Pknox1 UTSW 17 31595316 missense probably benign 0.23
R6865:Pknox1 UTSW 17 31588560 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCACACATCCCAGAGTGTTC -3'
(R):5'- GCTCAAGCCTGTTTCTAAGATTAC -3'

Sequencing Primer
(F):5'- GTTCTGGAGAGATGTGGCAC -3'
(R):5'- CAAGCCTGTTTCTAAGATTACATTGG -3'
Posted On2016-06-21