Mutagenetix > Incidental Mutation

Incidental Mutation 'R5128:Anapc1'

394850

Institutional Source

Beutler Lab

Gene Symbol

Anapc1

Ensembl Gene

ENSMUSG00000014355

Gene Name

anaphase promoting complex subunit 1

Synonyms

Apc1, tsg24, Mcpr, 2610021O03Rik

MMRRC Submission

042716-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128452024-128529311 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 128501837 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 735 (V735A)

Ref Sequence

ENSEMBL: ENSMUSP00000105962 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]

AlphaFold

P53995

Predicted Effect

probably benign
Transcript: ENSMUST00000014499
AA Change: V735A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: V735A

Domain	Start	End	E-Value	Type
Pfam:ANAPC1	150	214	1.7e-13	PFAM
low complexity region	323	345	N/A	INTRINSIC
low complexity region	1404	1415	N/A	INTRINSIC
Pfam:PC_rep	1467	1501	8.3e-8	PFAM
low complexity region	1516	1528	N/A	INTRINSIC
low complexity region	1924	1936	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110333
AA Change: V735A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: V735A

Domain	Start	End	E-Value	Type
Pfam:Apc1	149	227	1.7e-22	PFAM
low complexity region	323	345	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123503

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143007

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	G	7: 45,639,070 (GRCm39)	S958P	probably benign	Het
Ahnak	T	C	19: 8,994,451 (GRCm39)	L5245P	probably damaging	Het
Alg5	T	A	3: 54,649,558 (GRCm39)		probably null	Het
Arhgap45	A	G	10: 79,866,793 (GRCm39)	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,277,767 (GRCm39)	S2062A	probably damaging	Het
Chrna9	A	G	5: 66,128,565 (GRCm39)	S258G	probably benign	Het
Ctcfl	T	C	2: 172,959,189 (GRCm39)	E179G	probably benign	Het
Dcdc2a	C	A	13: 25,286,512 (GRCm39)	A145E	probably damaging	Het
Dgkz	A	G	2: 91,773,028 (GRCm39)	I343T	probably damaging	Het
Dnah1	T	C	14: 31,018,152 (GRCm39)		probably null	Het
Dqx1	T	C	6: 83,037,548 (GRCm39)	L374P	probably damaging	Het
Entpd5	A	T	12: 84,441,464 (GRCm39)	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468 (GRCm39)		probably benign	Het
Fgf1	C	A	18: 38,975,078 (GRCm39)	V124L	probably benign	Het
Gm16380	C	T	9: 53,791,397 (GRCm39)		noncoding transcript	Het
Grid2	G	A	6: 64,642,982 (GRCm39)	A915T	probably benign	Het
Inhbc	A	T	10: 127,193,611 (GRCm39)	M135K	probably benign	Het
Mertk	C	A	2: 128,580,167 (GRCm39)	T207K	probably damaging	Het
Mroh9	C	G	1: 162,888,329 (GRCm39)	G249R	probably damaging	Het
Mtmr10	C	T	7: 63,983,187 (GRCm39)	T498I	probably damaging	Het
Muc17	A	G	5: 137,167,034 (GRCm39)		probably null	Het
Nlrp1c-ps	G	T	11: 71,170,421 (GRCm39)		noncoding transcript	Het
Nphp4	T	A	4: 152,587,448 (GRCm39)	I267N	probably benign	Het
Obox8	A	G	7: 14,066,015 (GRCm39)	W168R	probably damaging	Het
Or2t48	A	T	11: 58,420,248 (GRCm39)	V188E	probably damaging	Het
Or4a74	A	T	2: 89,439,647 (GRCm39)	D266E	probably damaging	Het
Or8c8	T	C	9: 38,164,866 (GRCm39)	L48P	probably damaging	Het
Pafah1b1	A	G	11: 74,570,262 (GRCm39)		probably benign	Het
Palld	T	C	8: 62,173,622 (GRCm39)	T346A	probably damaging	Het
Pip4k2b	A	G	11: 97,609,702 (GRCm39)	S412P	probably benign	Het
Potefam1	G	A	2: 110,994,674 (GRCm39)	Q251*	probably null	Het
Scn3a	T	C	2: 65,338,862 (GRCm39)	S606G	probably benign	Het
Slc12a7	G	T	13: 73,953,552 (GRCm39)	S754I	probably benign	Het
Tep1	A	G	14: 51,081,736 (GRCm39)	*489R	probably null	Het
Tnn	A	T	1: 159,950,464 (GRCm39)	V714E	probably damaging	Het
Trappc9	A	T	15: 72,930,242 (GRCm39)	I38N	probably damaging	Het
Ttc16	T	A	2: 32,653,009 (GRCm39)	I550F	probably benign	Het
Vit	T	C	17: 78,932,575 (GRCm39)	S561P	probably damaging	Het
Zdhhc1	T	A	8: 106,210,268 (GRCm39)	I50F	probably benign	Het
Zfp451	C	T	1: 33,842,014 (GRCm39)		probably benign	Het
Zfp597	G	A	16: 3,689,988 (GRCm39)		probably benign	Het

Other mutations in Anapc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00232:Anapc1	APN	2	128,487,050 (GRCm39)	splice site	probably benign
IGL00704:Anapc1	APN	2	128,505,904 (GRCm39)	missense	possibly damaging	0.48
IGL01023:Anapc1	APN	2	128,471,649 (GRCm39)	missense	probably damaging	1.00
IGL01432:Anapc1	APN	2	128,475,328 (GRCm39)	missense	probably damaging	1.00
IGL01549:Anapc1	APN	2	128,495,090 (GRCm39)	missense	probably benign
IGL02089:Anapc1	APN	2	128,505,853 (GRCm39)	missense	probably damaging	1.00
IGL02275:Anapc1	APN	2	128,501,772 (GRCm39)	missense	probably benign
IGL02570:Anapc1	APN	2	128,487,120 (GRCm39)	missense	probably damaging	1.00
IGL02597:Anapc1	APN	2	128,465,851 (GRCm39)	missense	probably benign	0.02
IGL02726:Anapc1	APN	2	128,501,705 (GRCm39)	missense	probably benign	0.05
IGL03265:Anapc1	APN	2	128,469,117 (GRCm39)	missense	probably damaging	1.00
IGL03304:Anapc1	APN	2	128,469,033 (GRCm39)	splice site	probably benign
IGL03327:Anapc1	APN	2	128,465,854 (GRCm39)	missense	probably benign	0.00
R0023:Anapc1	UTSW	2	128,520,138 (GRCm39)	missense	probably damaging	0.99
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0027:Anapc1	UTSW	2	128,483,431 (GRCm39)	missense	possibly damaging	0.96
R0084:Anapc1	UTSW	2	128,465,886 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0103:Anapc1	UTSW	2	128,522,372 (GRCm39)	splice site	probably benign
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0109:Anapc1	UTSW	2	128,476,613 (GRCm39)	missense	probably damaging	1.00
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0241:Anapc1	UTSW	2	128,470,549 (GRCm39)	missense	possibly damaging	0.89
R0255:Anapc1	UTSW	2	128,476,631 (GRCm39)	missense	probably damaging	0.99
R0377:Anapc1	UTSW	2	128,483,260 (GRCm39)	critical splice donor site	probably null
R0467:Anapc1	UTSW	2	128,510,963 (GRCm39)	missense	probably damaging	0.99
R0514:Anapc1	UTSW	2	128,474,575 (GRCm39)	missense	probably damaging	0.99
R0591:Anapc1	UTSW	2	128,461,252 (GRCm39)	missense	probably benign	0.17
R0919:Anapc1	UTSW	2	128,459,651 (GRCm39)	missense	probably benign
R1175:Anapc1	UTSW	2	128,522,108 (GRCm39)	missense	probably damaging	1.00
R1473:Anapc1	UTSW	2	128,459,617 (GRCm39)	missense	possibly damaging	0.88
R1547:Anapc1	UTSW	2	128,459,476 (GRCm39)	missense	probably benign	0.44
R1556:Anapc1	UTSW	2	128,466,819 (GRCm39)	missense	probably benign	0.00
R1567:Anapc1	UTSW	2	128,459,636 (GRCm39)	missense	probably damaging	1.00
R1635:Anapc1	UTSW	2	128,470,452 (GRCm39)	missense	probably damaging	1.00
R1645:Anapc1	UTSW	2	128,500,166 (GRCm39)	critical splice donor site	probably null
R1677:Anapc1	UTSW	2	128,518,128 (GRCm39)	missense	probably benign	0.09
R1854:Anapc1	UTSW	2	128,517,810 (GRCm39)	missense	probably damaging	1.00
R1856:Anapc1	UTSW	2	128,501,708 (GRCm39)	missense	probably damaging	0.96
R1959:Anapc1	UTSW	2	128,475,335 (GRCm39)	missense	probably benign	0.36
R1984:Anapc1	UTSW	2	128,511,608 (GRCm39)	missense	possibly damaging	0.85
R2034:Anapc1	UTSW	2	128,490,378 (GRCm39)	missense	possibly damaging	0.92
R2283:Anapc1	UTSW	2	128,484,468 (GRCm39)	missense	probably benign	0.23
R2928:Anapc1	UTSW	2	128,522,057 (GRCm39)	missense	probably damaging	1.00
R3547:Anapc1	UTSW	2	128,484,602 (GRCm39)	missense	possibly damaging	0.58
R3904:Anapc1	UTSW	2	128,484,439 (GRCm39)	missense	probably damaging	1.00
R4156:Anapc1	UTSW	2	128,469,149 (GRCm39)	intron	probably benign
R4359:Anapc1	UTSW	2	128,465,476 (GRCm39)	missense	possibly damaging	0.64
R4392:Anapc1	UTSW	2	128,518,169 (GRCm39)	critical splice acceptor site	probably null
R4574:Anapc1	UTSW	2	128,469,115 (GRCm39)	missense	probably damaging	1.00
R4682:Anapc1	UTSW	2	128,505,925 (GRCm39)	missense	probably benign	0.05
R4770:Anapc1	UTSW	2	128,527,980 (GRCm39)	splice site	probably benign
R4824:Anapc1	UTSW	2	128,470,610 (GRCm39)	missense	possibly damaging	0.69
R4960:Anapc1	UTSW	2	128,526,514 (GRCm39)	missense	probably benign	0.23
R5016:Anapc1	UTSW	2	128,449,095 (GRCm39)	unclassified	probably benign
R5063:Anapc1	UTSW	2	128,471,469 (GRCm39)	missense	possibly damaging	0.48
R5271:Anapc1	UTSW	2	128,527,905 (GRCm39)	nonsense	probably null
R5363:Anapc1	UTSW	2	128,492,114 (GRCm39)	critical splice donor site	probably null
R5469:Anapc1	UTSW	2	128,517,621 (GRCm39)	nonsense	probably null
R5473:Anapc1	UTSW	2	128,449,115 (GRCm39)	unclassified	probably benign
R5559:Anapc1	UTSW	2	128,522,354 (GRCm39)	nonsense	probably null
R5631:Anapc1	UTSW	2	128,499,137 (GRCm39)	missense	possibly damaging	0.85
R5747:Anapc1	UTSW	2	128,466,836 (GRCm39)	missense	probably benign	0.19
R5840:Anapc1	UTSW	2	128,448,957 (GRCm39)	unclassified	probably benign
R6226:Anapc1	UTSW	2	128,492,292 (GRCm39)	missense	probably damaging	1.00
R6526:Anapc1	UTSW	2	128,514,055 (GRCm39)	nonsense	probably null
R6561:Anapc1	UTSW	2	128,505,919 (GRCm39)	missense	probably damaging	0.98
R6743:Anapc1	UTSW	2	128,526,454 (GRCm39)	nonsense	probably null
R6799:Anapc1	UTSW	2	128,501,657 (GRCm39)	missense	probably null	0.38
R6887:Anapc1	UTSW	2	128,501,688 (GRCm39)	missense	possibly damaging	0.91
R6978:Anapc1	UTSW	2	128,511,820 (GRCm39)	missense	probably benign	0.06
R7011:Anapc1	UTSW	2	128,490,601 (GRCm39)	splice site	probably null
R7041:Anapc1	UTSW	2	128,470,576 (GRCm39)	missense	possibly damaging	0.88
R7047:Anapc1	UTSW	2	128,457,350 (GRCm39)	missense	probably damaging	0.96
R7074:Anapc1	UTSW	2	128,520,194 (GRCm39)	missense	probably damaging	1.00
R7109:Anapc1	UTSW	2	128,516,522 (GRCm39)	missense	probably benign	0.33
R7123:Anapc1	UTSW	2	128,454,930 (GRCm39)	missense	probably damaging	1.00
R7309:Anapc1	UTSW	2	128,516,604 (GRCm39)	missense	probably damaging	0.96
R7693:Anapc1	UTSW	2	128,483,457 (GRCm39)	missense	possibly damaging	0.86
R7839:Anapc1	UTSW	2	128,526,528 (GRCm39)	missense	probably damaging	0.99
R7847:Anapc1	UTSW	2	128,511,828 (GRCm39)	missense	possibly damaging	0.93
R7960:Anapc1	UTSW	2	128,516,513 (GRCm39)	missense	probably damaging	1.00
R8061:Anapc1	UTSW	2	128,490,408 (GRCm39)	missense	probably damaging	0.98
R8127:Anapc1	UTSW	2	128,474,547 (GRCm39)	missense	probably damaging	0.96
R8228:Anapc1	UTSW	2	128,461,837 (GRCm39)	nonsense	probably null
R8402:Anapc1	UTSW	2	128,472,148 (GRCm39)	missense	probably benign	0.02
R8422:Anapc1	UTSW	2	128,517,757 (GRCm39)	missense	probably benign
R8425:Anapc1	UTSW	2	128,511,788 (GRCm39)	missense	probably damaging	1.00
R8469:Anapc1	UTSW	2	128,500,264 (GRCm39)	splice site	probably null
R8553:Anapc1	UTSW	2	128,461,833 (GRCm39)	missense	possibly damaging	0.80
R8688:Anapc1	UTSW	2	128,527,748 (GRCm39)	missense	probably benign	0.19
R8699:Anapc1	UTSW	2	128,483,373 (GRCm39)	missense	probably damaging	1.00
R8719:Anapc1	UTSW	2	128,483,369 (GRCm39)	missense	probably damaging	1.00
R8775:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8775-TAIL:Anapc1	UTSW	2	128,499,093 (GRCm39)	missense	possibly damaging	0.92
R8806:Anapc1	UTSW	2	128,464,333 (GRCm39)	missense	possibly damaging	0.67
R8973:Anapc1	UTSW	2	128,505,952 (GRCm39)	missense	probably damaging	0.99
R8977:Anapc1	UTSW	2	128,483,322 (GRCm39)	missense	probably damaging	1.00
R9000:Anapc1	UTSW	2	128,476,628 (GRCm39)	missense	probably damaging	1.00
R9080:Anapc1	UTSW	2	128,464,426 (GRCm39)	missense	possibly damaging	0.82
R9203:Anapc1	UTSW	2	128,465,422 (GRCm39)	missense	possibly damaging	0.66
R9314:Anapc1	UTSW	2	128,464,420 (GRCm39)	missense	possibly damaging	0.69
R9386:Anapc1	UTSW	2	128,459,642 (GRCm39)	missense	probably benign	0.08
R9415:Anapc1	UTSW	2	128,476,598 (GRCm39)	missense	probably benign
R9436:Anapc1	UTSW	2	128,518,045 (GRCm39)	missense	probably benign
R9516:Anapc1	UTSW	2	128,517,633 (GRCm39)	missense	possibly damaging	0.77
R9563:Anapc1	UTSW	2	128,505,980 (GRCm39)	nonsense	probably null
R9572:Anapc1	UTSW	2	128,505,976 (GRCm39)	missense	probably benign
R9757:Anapc1	UTSW	2	128,517,676 (GRCm39)	missense	probably damaging	1.00
R9766:Anapc1	UTSW	2	128,500,221 (GRCm39)	missense	probably damaging	1.00
X0066:Anapc1	UTSW	2	128,516,621 (GRCm39)	missense	probably benign	0.10

Predicted Primers

PCR Primer
(F):5'- CAACTGAACAAGGAGGTCGA -3'
(R):5'- CAGCATTTGCCCTTTTATGTATCA -3'

Sequencing Primer
(F):5'- GGTCGATAAGAGAACAAATTCCTTC -3'
(R):5'- GCCCATGGTGTCATAGATGTAACC -3'

Posted On

2016-06-21