Mutagenetix > Incidental Mutation

Incidental Mutation 'R5128:Grid2'

394857

Institutional Source

Beutler Lab

Gene Symbol

Grid2

Ensembl Gene

ENSMUSG00000071424

Gene Name

glutamate receptor, ionotropic, delta 2

Synonyms

tpr, B230104L07Rik, GluRdelta2

MMRRC Submission

042716-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5128 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63232860-64681307 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 64642982 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 915 (A915T)

Ref Sequence

ENSEMBL: ENSMUSP00000093536 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095852] [ENSMUST00000210324]

AlphaFold

Q61625

Predicted Effect

probably benign
Transcript: ENSMUST00000095852
AA Change: A915T

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000093536
Gene: ENSMUSG00000071424
AA Change: A915T

Domain	Start	End	E-Value	Type
Pfam:ANF_receptor	39	404	4.1e-41	PFAM
PBPe	442	807	5.98e-108	SMART
Lig_chan-Glu_bd	452	514	3.76e-24	SMART
transmembrane domain	830	852	N/A	INTRINSIC
low complexity region	945	956	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000210324

Meta Mutation Damage Score

0.0584

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.0%
20x: 94.5%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the family of ionotropic glutamate receptors which are the predominant excitatory neurotransmitter receptors in the mammalian brain. The encoded protein is a multi-pass membrane protein that is expressed selectively in cerebellar Purkinje cells. A point mutation in the mouse ortholog, associated with the phenotype named 'lurcher', in the heterozygous state leads to ataxia resulting from selective, cell-autonomous apoptosis of cerebellar Purkinje cells during postnatal development. Mice homozygous for this mutation die shortly after birth from massive loss of mid- and hindbrain neurons during late embryogenesis. This protein also plays a role in synapse organization between parallel fibers and Purkinje cells. Alternate splicing results in multiple transcript variants encoding distinct isoforms. Mutations in this gene cause cerebellar ataxia in humans. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygotes for multiple spontaneous and targeted null mutations exhibit ataxia and impaired locomotion associated with cerebellar Purkinje cell abnormalities and loss, and on some backgrounds, male infertility due to lack of zona penetration by sperm. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	A	G	7: 45,639,070 (GRCm39)	S958P	probably benign	Het
Ahnak	T	C	19: 8,994,451 (GRCm39)	L5245P	probably damaging	Het
Alg5	T	A	3: 54,649,558 (GRCm39)		probably null	Het
Anapc1	A	G	2: 128,501,837 (GRCm39)	V735A	probably benign	Het
Arhgap45	A	G	10: 79,866,793 (GRCm39)	T1099A	probably benign	Het
Cacna1e	A	C	1: 154,277,767 (GRCm39)	S2062A	probably damaging	Het
Chrna9	A	G	5: 66,128,565 (GRCm39)	S258G	probably benign	Het
Ctcfl	T	C	2: 172,959,189 (GRCm39)	E179G	probably benign	Het
Dcdc2a	C	A	13: 25,286,512 (GRCm39)	A145E	probably damaging	Het
Dgkz	A	G	2: 91,773,028 (GRCm39)	I343T	probably damaging	Het
Dnah1	T	C	14: 31,018,152 (GRCm39)		probably null	Het
Dqx1	T	C	6: 83,037,548 (GRCm39)	L374P	probably damaging	Het
Entpd5	A	T	12: 84,441,464 (GRCm39)	F101L	probably benign	Het
Esco1	A	T	18: 10,567,468 (GRCm39)		probably benign	Het
Fgf1	C	A	18: 38,975,078 (GRCm39)	V124L	probably benign	Het
Gm16380	C	T	9: 53,791,397 (GRCm39)		noncoding transcript	Het
Inhbc	A	T	10: 127,193,611 (GRCm39)	M135K	probably benign	Het
Mertk	C	A	2: 128,580,167 (GRCm39)	T207K	probably damaging	Het
Mroh9	C	G	1: 162,888,329 (GRCm39)	G249R	probably damaging	Het
Mtmr10	C	T	7: 63,983,187 (GRCm39)	T498I	probably damaging	Het
Muc17	A	G	5: 137,167,034 (GRCm39)		probably null	Het
Nlrp1c-ps	G	T	11: 71,170,421 (GRCm39)		noncoding transcript	Het
Nphp4	T	A	4: 152,587,448 (GRCm39)	I267N	probably benign	Het
Obox8	A	G	7: 14,066,015 (GRCm39)	W168R	probably damaging	Het
Or2t48	A	T	11: 58,420,248 (GRCm39)	V188E	probably damaging	Het
Or4a74	A	T	2: 89,439,647 (GRCm39)	D266E	probably damaging	Het
Or8c8	T	C	9: 38,164,866 (GRCm39)	L48P	probably damaging	Het
Pafah1b1	A	G	11: 74,570,262 (GRCm39)		probably benign	Het
Palld	T	C	8: 62,173,622 (GRCm39)	T346A	probably damaging	Het
Pip4k2b	A	G	11: 97,609,702 (GRCm39)	S412P	probably benign	Het
Potefam1	G	A	2: 110,994,674 (GRCm39)	Q251*	probably null	Het
Scn3a	T	C	2: 65,338,862 (GRCm39)	S606G	probably benign	Het
Slc12a7	G	T	13: 73,953,552 (GRCm39)	S754I	probably benign	Het
Tep1	A	G	14: 51,081,736 (GRCm39)	*489R	probably null	Het
Tnn	A	T	1: 159,950,464 (GRCm39)	V714E	probably damaging	Het
Trappc9	A	T	15: 72,930,242 (GRCm39)	I38N	probably damaging	Het
Ttc16	T	A	2: 32,653,009 (GRCm39)	I550F	probably benign	Het
Vit	T	C	17: 78,932,575 (GRCm39)	S561P	probably damaging	Het
Zdhhc1	T	A	8: 106,210,268 (GRCm39)	I50F	probably benign	Het
Zfp451	C	T	1: 33,842,014 (GRCm39)		probably benign	Het
Zfp597	G	A	16: 3,689,988 (GRCm39)		probably benign	Het

Other mutations in Grid2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00580:Grid2	APN	6	64,322,573 (GRCm39)	missense	probably damaging	1.00
IGL00596:Grid2	APN	6	64,510,688 (GRCm39)	missense	possibly damaging	0.93
IGL01686:Grid2	APN	6	64,297,180 (GRCm39)	missense	probably benign	0.00
IGL01712:Grid2	APN	6	64,642,899 (GRCm39)	missense	possibly damaging	0.73
IGL02064:Grid2	APN	6	64,040,919 (GRCm39)	missense	probably benign	0.29
IGL02216:Grid2	APN	6	64,322,650 (GRCm39)	missense	probably damaging	0.96
IGL02563:Grid2	APN	6	64,322,857 (GRCm39)	missense	possibly damaging	0.94
IGL02685:Grid2	APN	6	64,322,800 (GRCm39)	missense	possibly damaging	0.50
IGL03129:Grid2	APN	6	64,040,888 (GRCm39)	missense	probably damaging	0.98
IGL03324:Grid2	APN	6	64,406,806 (GRCm39)	missense	possibly damaging	0.88
IGL03395:Grid2	APN	6	63,886,053 (GRCm39)	missense	possibly damaging	0.94
crawler	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
swagger	UTSW	6	64,372,263 (GRCm39)	synonymous	probably benign
R0133:Grid2	UTSW	6	64,297,116 (GRCm39)	missense	probably damaging	1.00
R0147:Grid2	UTSW	6	64,510,571 (GRCm39)	missense	probably benign
R0193:Grid2	UTSW	6	64,040,937 (GRCm39)	missense	possibly damaging	0.64
R0370:Grid2	UTSW	6	64,322,718 (GRCm39)	missense	possibly damaging	0.75
R0399:Grid2	UTSW	6	64,643,036 (GRCm39)	missense	probably benign	0.33
R0600:Grid2	UTSW	6	63,480,419 (GRCm39)	missense	probably benign	0.38
R0717:Grid2	UTSW	6	64,643,259 (GRCm39)	missense	possibly damaging	0.96
R1524:Grid2	UTSW	6	64,406,738 (GRCm39)	missense	possibly damaging	0.92
R1555:Grid2	UTSW	6	64,406,668 (GRCm39)	missense	possibly damaging	0.87
R1572:Grid2	UTSW	6	64,406,678 (GRCm39)	nonsense	probably null
R1762:Grid2	UTSW	6	64,510,638 (GRCm39)	missense	probably damaging	0.98
R1944:Grid2	UTSW	6	63,886,045 (GRCm39)	missense	probably damaging	1.00
R1961:Grid2	UTSW	6	63,885,877 (GRCm39)	missense	probably damaging	1.00
R1969:Grid2	UTSW	6	63,885,902 (GRCm39)	nonsense	probably null
R2138:Grid2	UTSW	6	64,322,782 (GRCm39)	missense	probably damaging	0.99
R3500:Grid2	UTSW	6	63,480,383 (GRCm39)	missense	probably damaging	0.97
R3547:Grid2	UTSW	6	64,297,005 (GRCm39)	missense	probably damaging	0.97
R3845:Grid2	UTSW	6	64,322,826 (GRCm39)	missense	possibly damaging	0.62
R4124:Grid2	UTSW	6	63,480,417 (GRCm39)	missense	probably benign	0.41
R4273:Grid2	UTSW	6	63,886,029 (GRCm39)	missense	probably damaging	1.00
R4591:Grid2	UTSW	6	64,297,086 (GRCm39)	missense	probably damaging	1.00
R4701:Grid2	UTSW	6	64,642,899 (GRCm39)	missense	probably benign	0.27
R4721:Grid2	UTSW	6	64,643,185 (GRCm39)	missense	probably benign	0.33
R4755:Grid2	UTSW	6	63,885,972 (GRCm39)	missense	probably benign	0.04
R4869:Grid2	UTSW	6	64,406,724 (GRCm39)	missense	probably damaging	1.00
R5083:Grid2	UTSW	6	64,297,136 (GRCm39)	nonsense	probably null
R5091:Grid2	UTSW	6	64,053,862 (GRCm39)	missense	probably benign	0.07
R5117:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R5386:Grid2	UTSW	6	63,908,089 (GRCm39)	missense	probably damaging	0.99
R5404:Grid2	UTSW	6	63,907,894 (GRCm39)	missense	probably damaging	0.99
R5534:Grid2	UTSW	6	63,480,345 (GRCm39)	missense	probably benign
R5626:Grid2	UTSW	6	64,053,929 (GRCm39)	critical splice donor site	probably null
R5699:Grid2	UTSW	6	63,885,975 (GRCm39)	missense	probably damaging	0.99
R5700:Grid2	UTSW	6	64,071,416 (GRCm39)	missense	possibly damaging	0.95
R5876:Grid2	UTSW	6	64,640,146 (GRCm39)	missense	probably damaging	1.00
R6446:Grid2	UTSW	6	64,322,577 (GRCm39)	missense	probably damaging	1.00
R6694:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6697:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6699:Grid2	UTSW	6	63,908,031 (GRCm39)	missense	possibly damaging	0.92
R6767:Grid2	UTSW	6	63,907,999 (GRCm39)	missense	probably benign	0.01
R6895:Grid2	UTSW	6	64,372,283 (GRCm39)	missense	probably damaging	0.99
R6999:Grid2	UTSW	6	64,053,893 (GRCm39)	missense	possibly damaging	0.80
R7053:Grid2	UTSW	6	64,677,402 (GRCm39)	missense	unknown
R7126:Grid2	UTSW	6	64,053,794 (GRCm39)	missense	probably damaging	0.99
R7432:Grid2	UTSW	6	64,252,854 (GRCm39)	missense	possibly damaging	0.46
R7553:Grid2	UTSW	6	64,053,925 (GRCm39)	missense	possibly damaging	0.95
R7619:Grid2	UTSW	6	63,908,085 (GRCm39)	missense	possibly damaging	0.71
R7997:Grid2	UTSW	6	64,297,120 (GRCm39)	missense	possibly damaging	0.89
R8112:Grid2	UTSW	6	63,885,891 (GRCm39)	missense	probably damaging	0.99
R8296:Grid2	UTSW	6	63,233,929 (GRCm39)	critical splice donor site	probably null
R8320:Grid2	UTSW	6	63,233,917 (GRCm39)	missense	probably benign	0.15
R8467:Grid2	UTSW	6	64,510,635 (GRCm39)	missense	probably benign	0.01
R8691:Grid2	UTSW	6	63,480,321 (GRCm39)	missense	probably damaging	0.97
R8890:Grid2	UTSW	6	63,233,923 (GRCm39)	missense	probably benign
R8965:Grid2	UTSW	6	64,296,990 (GRCm39)	missense	probably damaging	1.00
R8968:Grid2	UTSW	6	64,643,139 (GRCm39)	missense	probably benign	0.14
R9220:Grid2	UTSW	6	63,885,888 (GRCm39)	missense	probably damaging	1.00
R9371:Grid2	UTSW	6	64,677,506 (GRCm39)	missense	unknown
R9653:Grid2	UTSW	6	63,907,968 (GRCm39)	missense	possibly damaging	0.75
Z1176:Grid2	UTSW	6	64,640,212 (GRCm39)	missense	probably benign	0.03
Z1176:Grid2	UTSW	6	63,885,863 (GRCm39)	missense	possibly damaging	0.76
Z1177:Grid2	UTSW	6	64,322,841 (GRCm39)	missense	probably damaging	1.00
Z1177:Grid2	UTSW	6	64,322,840 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACATGTTTGCTGAACGACTTC -3'
(R):5'- TAGGAGCCCTGTGCCTAAAAG -3'

Sequencing Primer
(F):5'- CATGGAAGCTAGTACTGATGAGATCC -3'
(R):5'- CCTAAAAGGGCCAGTTCGGTG -3'

Posted On

2016-06-21