Incidental Mutation 'R5128:Mtmr10'
ID394861
Institutional Source Beutler Lab
Gene Symbol Mtmr10
Ensembl Gene ENSMUSG00000030522
Gene Namemyotubularin related protein 10
Synonyms
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R5128 (G1)
Quality Score219
Status Validated
Chromosome7
Chromosomal Location64287653-64340806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64333439 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 498 (T498I)
Ref Sequence ENSEMBL: ENSMUSP00000032736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032736] [ENSMUST00000206452]
Predicted Effect probably damaging
Transcript: ENSMUST00000032736
AA Change: T498I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032736
Gene: ENSMUSG00000030522
AA Change: T498I

DomainStartEndE-ValueType
Pfam:Myotub-related 176 330 8.6e-12 PFAM
Pfam:Myotub-related 319 508 2.7e-56 PFAM
Pfam:3-PAP 570 701 2.2e-57 PFAM
low complexity region 730 737 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173374
Predicted Effect probably benign
Transcript: ENSMUST00000206452
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dcdc2a C A 13: 25,102,529 A145E probably damaging Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Mtmr10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01999:Mtmr10 APN 7 64337712 missense probably benign
IGL02082:Mtmr10 APN 7 64333490 splice site probably benign
IGL02234:Mtmr10 APN 7 64299602 missense probably benign 0.04
IGL02448:Mtmr10 APN 7 64308150 missense probably damaging 1.00
IGL02515:Mtmr10 APN 7 64337511 missense probably damaging 1.00
Curlyq UTSW 7 64333439 missense probably damaging 1.00
K7371:Mtmr10 UTSW 7 64314210 missense probably benign 0.18
PIT4472001:Mtmr10 UTSW 7 64333358 missense probably benign 0.23
R0302:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R0619:Mtmr10 UTSW 7 64321213 missense probably benign 0.00
R0787:Mtmr10 UTSW 7 64300615 missense possibly damaging 0.95
R0972:Mtmr10 UTSW 7 64326709 missense probably damaging 1.00
R1482:Mtmr10 UTSW 7 64314249 missense probably damaging 1.00
R1770:Mtmr10 UTSW 7 64336721 missense possibly damaging 0.47
R1826:Mtmr10 UTSW 7 64337466 missense probably benign 0.00
R2174:Mtmr10 UTSW 7 64336764 missense possibly damaging 0.94
R2215:Mtmr10 UTSW 7 64337655 missense probably benign 0.00
R2352:Mtmr10 UTSW 7 64297580 missense possibly damaging 0.71
R2411:Mtmr10 UTSW 7 64297497 missense probably damaging 1.00
R3702:Mtmr10 UTSW 7 64337899 missense probably damaging 1.00
R3710:Mtmr10 UTSW 7 64326685 missense possibly damaging 0.86
R3802:Mtmr10 UTSW 7 64320628 missense probably benign 0.29
R4190:Mtmr10 UTSW 7 64314186 missense probably benign 0.37
R4484:Mtmr10 UTSW 7 64320631 missense possibly damaging 0.86
R4562:Mtmr10 UTSW 7 64314159 missense possibly damaging 0.92
R5203:Mtmr10 UTSW 7 64318161 missense probably benign
R5444:Mtmr10 UTSW 7 64288401 unclassified probably null
R5627:Mtmr10 UTSW 7 64336752 missense probably damaging 1.00
R5786:Mtmr10 UTSW 7 64337710 missense probably damaging 1.00
R7078:Mtmr10 UTSW 7 64320627 missense possibly damaging 0.65
R7236:Mtmr10 UTSW 7 64314184 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- CAGAGAGCAGCATTAAATAACCC -3'
(R):5'- CACCAAAGAAATCCAAAAGTGTATTT -3'

Sequencing Primer
(F):5'- GAGAGCAGCATTAAATAACCCCTTTG -3'
(R):5'- GTTTGGATCCCAGAACCCATGTAAG -3'
Posted On2016-06-21