Incidental Mutation 'R5128:Dcdc2a'
ID394875
Institutional Source Beutler Lab
Gene Symbol Dcdc2a
Ensembl Gene ENSMUSG00000035910
Gene Namedoublecortin domain containing 2a
SynonymsRU2, Dcdc2
MMRRC Submission 042716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.363) question?
Stock #R5128 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location25056004-25210706 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25102529 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Glutamic Acid at position 145 (A145E)
Ref Sequence ENSEMBL: ENSMUSP00000047641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036932] [ENSMUST00000069614]
Predicted Effect probably damaging
Transcript: ENSMUST00000036932
AA Change: A145E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047641
Gene: ENSMUSG00000035910
AA Change: A145E

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000069614
AA Change: A145E

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000063650
Gene: ENSMUSG00000035910
AA Change: A145E

DomainStartEndE-ValueType
DCX 12 100 2.93e-40 SMART
DCX 134 221 1.76e-34 SMART
low complexity region 286 299 N/A INTRINSIC
low complexity region 325 340 N/A INTRINSIC
coiled coil region 409 437 N/A INTRINSIC
low complexity region 461 475 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159129
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: This gene encodes a member of the doublecortin family. The protein encoded by this gene contains two doublecortin domains. The doublecortin domain has been demonstrated to bind tubulin and enhance microtubule polymerization. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired short term object recognition, impaired visuo-spatial learning and memory and increased anxiety-related response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930430A15Rik G A 2: 111,164,329 Q251* probably null Het
Abcc6 A G 7: 45,989,646 S958P probably benign Het
Ahnak T C 19: 9,017,087 L5245P probably damaging Het
Alg5 T A 3: 54,742,137 probably null Het
Anapc1 A G 2: 128,659,917 V735A probably benign Het
Arhgap45 A G 10: 80,030,959 T1099A probably benign Het
Cacna1e A C 1: 154,402,021 S2062A probably damaging Het
Chrna9 A G 5: 65,971,222 S258G probably benign Het
Ctcfl T C 2: 173,117,396 E179G probably benign Het
Dgkz A G 2: 91,942,683 I343T probably damaging Het
Dnah1 T C 14: 31,296,195 probably null Het
Dqx1 T C 6: 83,060,567 L374P probably damaging Het
Entpd5 A T 12: 84,394,690 F101L probably benign Het
Esco1 A T 18: 10,567,468 probably benign Het
Fgf1 C A 18: 38,842,025 V124L probably benign Het
Gm16380 C T 9: 53,884,113 noncoding transcript Het
Grid2 G A 6: 64,665,998 A915T probably benign Het
Inhbc A T 10: 127,357,742 M135K probably benign Het
Mertk C A 2: 128,738,247 T207K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mtmr10 C T 7: 64,333,439 T498I probably damaging Het
Muc3 A G 5: 137,138,186 probably null Het
Nlrp1c-ps G T 11: 71,279,595 noncoding transcript Het
Nphp4 T A 4: 152,502,991 I267N probably benign Het
Obox8 A G 7: 14,332,090 W168R probably damaging Het
Olfr1247 A T 2: 89,609,303 D266E probably damaging Het
Olfr143 T C 9: 38,253,570 L48P probably damaging Het
Olfr330 A T 11: 58,529,422 V188E probably damaging Het
Pafah1b1 A G 11: 74,679,436 probably benign Het
Palld T C 8: 61,720,588 T346A probably damaging Het
Pip4k2b A G 11: 97,718,876 S412P probably benign Het
Scn3a T C 2: 65,508,518 S606G probably benign Het
Slc12a7 G T 13: 73,805,433 S754I probably benign Het
Tep1 A G 14: 50,844,279 *489R probably null Het
Tnn A T 1: 160,122,894 V714E probably damaging Het
Trappc9 A T 15: 73,058,393 I38N probably damaging Het
Ttc16 T A 2: 32,762,997 I550F probably benign Het
Vit T C 17: 78,625,146 S561P probably damaging Het
Zdhhc1 T A 8: 105,483,636 I50F probably benign Het
Zfp451 C T 1: 33,802,933 probably benign Het
Zfp597 G A 16: 3,872,124 probably benign Het
Other mutations in Dcdc2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Dcdc2a APN 13 25119329 missense probably benign 0.00
IGL01314:Dcdc2a APN 13 25102604 missense probably damaging 1.00
IGL02171:Dcdc2a APN 13 25056434 missense probably damaging 1.00
IGL02490:Dcdc2a APN 13 25107652 missense probably damaging 1.00
R0128:Dcdc2a UTSW 13 25187672 splice site probably benign
R0130:Dcdc2a UTSW 13 25187672 splice site probably benign
R0366:Dcdc2a UTSW 13 25056434 missense probably damaging 1.00
R0507:Dcdc2a UTSW 13 25102589 missense probably damaging 0.99
R0514:Dcdc2a UTSW 13 25119386 missense probably benign 0.04
R1055:Dcdc2a UTSW 13 25102610 missense probably damaging 0.99
R1170:Dcdc2a UTSW 13 25056307 missense probably benign 0.34
R1301:Dcdc2a UTSW 13 25102586 missense possibly damaging 0.93
R1514:Dcdc2a UTSW 13 25061254 missense probably benign 0.05
R1842:Dcdc2a UTSW 13 25107602 missense probably damaging 1.00
R2060:Dcdc2a UTSW 13 25107710 missense possibly damaging 0.59
R2121:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2122:Dcdc2a UTSW 13 25119285 missense possibly damaging 0.93
R2900:Dcdc2a UTSW 13 25120498 missense probably benign 0.01
R3153:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R3154:Dcdc2a UTSW 13 25102357 missense probably benign 0.03
R4353:Dcdc2a UTSW 13 25056491 missense probably damaging 1.00
R4608:Dcdc2a UTSW 13 25061240 nonsense probably null
R5099:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R5181:Dcdc2a UTSW 13 25202364 missense possibly damaging 0.94
R5271:Dcdc2a UTSW 13 25187688 missense probably benign 0.35
R5869:Dcdc2a UTSW 13 25107730 missense probably benign 0.05
R6058:Dcdc2a UTSW 13 25056371 missense possibly damaging 0.82
R6146:Dcdc2a UTSW 13 25205457 missense probably benign 0.35
R6892:Dcdc2a UTSW 13 25056460 missense probably damaging 1.00
R6956:Dcdc2a UTSW 13 25119366 missense probably benign 0.02
R6972:Dcdc2a UTSW 13 25120389 intron probably benign
R6973:Dcdc2a UTSW 13 25120389 intron probably benign
R7097:Dcdc2a UTSW 13 25107698 missense probably benign 0.12
R7247:Dcdc2a UTSW 13 25102391 missense probably benign 0.00
R7390:Dcdc2a UTSW 13 25107617 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CCCTTTGCTTTTGAAGGTGAAAC -3'
(R):5'- AGCCTTTGGGGACATCTTCG -3'

Sequencing Primer
(F):5'- GTCATTCACAGCAGGATCAACGTG -3'
(R):5'- GGGACATCTTCGAGGATTCC -3'
Posted On2016-06-21