Incidental Mutation 'R0448:Brcc3'
ID39488
Institutional Source Beutler Lab
Gene Symbol Brcc3
Ensembl Gene ENSMUSG00000031201
Gene NameBRCA1/BRCA2-containing complex, subunit 3
SynonymsC6.1A
MMRRC Submission 038648-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R0448 (G1)
Quality Score225
Status Validated
ChromosomeX
Chromosomal Location75416628-75454001 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 75450041 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 222 (L222*)
Ref Sequence ENSEMBL: ENSMUSP00000114057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033544] [ENSMUST00000114074] [ENSMUST00000118428]
Predicted Effect probably null
Transcript: ENSMUST00000033544
AA Change: L266*
SMART Domains Protein: ENSMUSP00000033544
Gene: ENSMUSG00000031201
AA Change: L266*

DomainStartEndE-ValueType
JAB_MPN 11 178 3.77e-41 SMART
coiled coil region 258 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114074
AA Change: L266*
SMART Domains Protein: ENSMUSP00000109708
Gene: ENSMUSG00000031201
AA Change: L266*

DomainStartEndE-ValueType
JAB_MPN 11 178 3.77e-41 SMART
coiled coil region 258 291 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000118428
AA Change: L222*
SMART Domains Protein: ENSMUSP00000114057
Gene: ENSMUSG00000031201
AA Change: L222*

DomainStartEndE-ValueType
JAB_MPN 11 178 3.77e-41 SMART
coiled coil region 214 247 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124321
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151938
Meta Mutation Damage Score 0.6496 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 93.1%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the BRCA1-BRCA2-containing complex (BRCC), which is an E3 ubiquitin ligase. This complex plays a role in the DNA damage response, where it is responsible for the stable accumulation of BRCA1 at DNA break sites. The component encoded by this gene can specifically cleave Lys 63-linked polyubiquitin chains, and it regulates the abundance of these polyubiquitin chains in chromatin. The loss of this gene results in abnormal angiogenesis and is associated with syndromic moyamoya, a cerebrovascular angiopathy. Alternative splicing results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,933,057 S643C probably damaging Het
9530053A07Rik T C 7: 28,140,235 I491T probably benign Het
Abcc5 G A 16: 20,399,937 R232C probably damaging Het
Adam9 A G 8: 24,964,910 S732P probably damaging Het
Add2 G A 6: 86,092,919 V140I probably benign Het
Ahi1 G A 10: 20,972,075 G461S probably damaging Het
Arhgef7 A G 8: 11,819,659 T432A possibly damaging Het
Arsi T C 18: 60,917,302 I419T probably damaging Het
Brca1 G A 11: 101,508,221 P1515L possibly damaging Het
Brpf3 A T 17: 28,806,036 T28S probably benign Het
Cdc20b T A 13: 113,078,657 V253E probably damaging Het
Cnot6l T A 5: 96,080,046 S443C probably benign Het
Copg1 G A 6: 87,904,926 A587T probably benign Het
Crebrf A G 17: 26,743,102 D391G probably benign Het
Crocc A T 4: 141,042,191 D283E probably damaging Het
Cryga T C 1: 65,103,159 N25S probably benign Het
Csnk1g1 T C 9: 65,980,948 F90L possibly damaging Het
Cyp2j6 A G 4: 96,545,728 V115A probably benign Het
Cyp3a11 T C 5: 145,862,394 I328V probably benign Het
Dchs1 C A 7: 105,765,927 E683D probably benign Het
Dnah9 T C 11: 65,918,713 probably benign Het
Dqx1 T C 6: 83,060,345 S330P probably damaging Het
Epg5 A G 18: 78,023,365 Y2160C probably damaging Het
Ercc5 T C 1: 44,173,940 L742P probably damaging Het
Flt1 C T 5: 147,566,394 probably benign Het
Gm9513 T A 9: 36,477,116 M79K probably benign Het
Grip2 A G 6: 91,779,213 S498P probably damaging Het
H2-T22 A G 17: 36,042,386 L14P possibly damaging Het
Hephl1 C T 9: 15,076,926 G629S probably damaging Het
Hsdl2 T A 4: 59,606,523 M162K unknown Het
Kcnh8 C A 17: 52,977,620 probably null Het
Krt76 T C 15: 101,890,647 Q201R probably damaging Het
Lrpprc A T 17: 84,770,894 Y319N probably benign Het
Lrrk2 T G 15: 91,709,305 I489R probably damaging Het
Mboat1 G T 13: 30,202,410 D136Y probably damaging Het
Mcmdc2 T C 1: 9,940,542 *682Q probably null Het
Msx2 C A 13: 53,468,395 R193L probably damaging Het
Nfatc4 T G 14: 55,831,654 D625E possibly damaging Het
Nup153 T C 13: 46,717,181 E86G probably benign Het
Olfr1295 T A 2: 111,565,214 I77F probably benign Het
Olfr130 G T 17: 38,067,672 R167L probably benign Het
Pard3b T C 1: 62,166,469 L474P probably damaging Het
Pggt1b A T 18: 46,262,972 probably benign Het
Pik3r2 A G 8: 70,772,044 probably benign Het
Prr14 A G 7: 127,474,726 probably benign Het
Rcbtb2 T C 14: 73,178,429 probably benign Het
Rufy2 G A 10: 63,004,736 D429N probably benign Het
S1pr5 T A 9: 21,244,207 T308S probably damaging Het
Sephs1 A G 2: 4,899,560 T250A probably benign Het
Serpina12 A G 12: 104,038,095 S93P probably benign Het
Serpinb1b T G 13: 33,089,692 H123Q probably benign Het
Sftpc C T 14: 70,522,680 V46I probably benign Het
Skint8 T A 4: 111,936,890 V159D probably damaging Het
Slc25a11 T C 11: 70,645,579 N134S probably benign Het
Slc25a24 T C 3: 109,157,016 probably benign Het
Sorl1 C G 9: 42,004,088 V1282L probably damaging Het
Sptan1 T A 2: 30,026,810 I2170N probably damaging Het
Syne4 A G 7: 30,314,920 probably benign Het
Tcam1 G A 11: 106,284,078 E120K probably benign Het
Tg C A 15: 66,764,442 P626Q probably damaging Het
Thoc6 T A 17: 23,669,576 D196V probably damaging Het
Tpi1 A G 6: 124,814,103 F57S probably damaging Het
Tril A G 6: 53,817,808 *810Q probably null Het
Trrap T A 5: 144,839,567 V2972D possibly damaging Het
Ttn T C 2: 76,720,939 M31370V probably damaging Het
Ttn A T 2: 76,761,280 V12688E probably damaging Het
Txndc11 A G 16: 11,091,761 F307S probably damaging Het
Vmn1r40 C T 6: 89,714,660 S153L probably benign Het
Vmn2r95 A G 17: 18,451,743 T581A possibly damaging Het
Wdtc1 A G 4: 133,297,500 F462S probably damaging Het
Zfp101 A G 17: 33,382,321 S154P possibly damaging Het
Zmym6 A G 4: 127,108,694 N481D probably benign Het
Other mutations in Brcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Brcc3 APN X 75422783 missense possibly damaging 0.82
IGL02634:Brcc3 APN X 75436098 unclassified probably benign
IGL02929:Brcc3 APN X 75435499 missense possibly damaging 0.77
X0066:Brcc3 UTSW X 75436175 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TCTGTGCCCACAACTGAGGTACTG -3'
(R):5'- TTCCCAGGATGCAACAGGCTCAAC -3'

Sequencing Primer
(F):5'- CATCCCAGTGAATAGTACTTTTCCAG -3'
(R):5'- GAAGGAATGCTATGCTCATCAC -3'
Posted On2013-05-23