Incidental Mutation 'R5130:Myo18b'
ID394948
Institutional Source Beutler Lab
Gene Symbol Myo18b
Ensembl Gene ENSMUSG00000072720
Gene Namemyosin XVIIIb
Synonyms4932408L24Rik, 4933411E19Rik
MMRRC Submission 042718-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5130 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location112688876-112896362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112873903 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 541 (D541G)
Ref Sequence ENSEMBL: ENSMUSP00000083810 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086617]
Predicted Effect probably benign
Transcript: ENSMUST00000086617
AA Change: D541G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000083810
Gene: ENSMUSG00000072720
AA Change: D541G

DomainStartEndE-ValueType
low complexity region 20 28 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 86 100 N/A INTRINSIC
low complexity region 185 200 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
low complexity region 291 304 N/A INTRINSIC
low complexity region 355 372 N/A INTRINSIC
low complexity region 377 419 N/A INTRINSIC
MYSc 605 1374 8.78e-30 SMART
IQ 1375 1397 5.92e-4 SMART
Pfam:Myosin_tail_1 1423 1875 5e-12 PFAM
low complexity region 1965 1985 N/A INTRINSIC
coiled coil region 2052 2126 N/A INTRINSIC
low complexity region 2184 2199 N/A INTRINSIC
low complexity region 2325 2336 N/A INTRINSIC
low complexity region 2408 2424 N/A INTRINSIC
low complexity region 2544 2558 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183029
Predicted Effect probably benign
Transcript: ENSMUST00000183273
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.4%
Validation Efficiency 96% (51/53)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene may regulate muscle-specific genes when in the nucleus and may influence intracellular trafficking when in the cytoplasm. The encoded protein functions as a homodimer and may interact with F actin. Mutations in this gene are associated with lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with internal hemorrhage, pericaridal effusion, enlargement of the right atrium, and cardiac myofibril abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930558K02Rik T C 1: 161,952,615 N110S possibly damaging Het
4932431P20Rik T C 7: 29,529,274 noncoding transcript Het
Acss3 T C 10: 107,004,725 I392V possibly damaging Het
Agbl5 G A 5: 30,903,059 R141Q probably damaging Het
Arhgef11 A G 3: 87,726,014 H696R possibly damaging Het
Baiap3 G T 17: 25,245,342 D847E probably benign Het
Cdc27 T C 11: 104,534,774 K72R probably benign Het
Cry2 T C 2: 92,424,599 E137G probably benign Het
Dhodh A T 8: 109,595,756 L237Q possibly damaging Het
Dscam A T 16: 96,819,779 N576K probably benign Het
Eng A G 2: 32,681,506 N636S probably damaging Het
Ephx2 A T 14: 66,108,062 I151K probably damaging Het
Fahd1 A G 17: 24,849,759 C115R probably damaging Het
Fer1l4 T A 2: 156,049,466 I143F possibly damaging Het
Iqgap3 C A 3: 88,108,854 N981K probably damaging Het
Kcna5 T C 6: 126,534,533 I211V probably benign Het
Mcm9 A T 10: 53,630,399 V14E possibly damaging Het
Mlh1 A G 9: 111,229,838 probably null Het
Mylk A G 16: 34,988,997 K1775E probably damaging Het
Ncapd2 A T 6: 125,169,924 M1233K possibly damaging Het
Nf2 A T 11: 4,829,862 probably benign Het
Nova2 C T 7: 18,926,144 T22I unknown Het
Olfr411 A T 11: 74,347,167 M19K probably damaging Het
Olfr846 T A 9: 19,361,073 Y94F possibly damaging Het
Olfr874 T A 9: 37,746,509 I125N probably damaging Het
Pcdha2 A T 18: 36,940,669 N451I probably damaging Het
Pcdhb12 T A 18: 37,435,824 F8I probably benign Het
Pdzph1 A C 17: 58,922,609 L1018W probably damaging Het
Prdm9 T C 17: 15,544,467 R684G probably benign Het
Rabep1 T A 11: 70,904,731 V261E probably damaging Het
Ros1 T A 10: 52,163,941 Y318F possibly damaging Het
Samd9l A T 6: 3,374,548 D904E possibly damaging Het
Siah3 A T 14: 75,525,941 K211* probably null Het
Slc5a8 T A 10: 88,926,215 N572K probably benign Het
Slfn8 A G 11: 83,003,821 F664S probably benign Het
Sowahb T A 5: 93,042,771 K696N possibly damaging Het
St7l A T 3: 104,895,764 H330L probably damaging Het
Tnrc6c T A 11: 117,738,350 probably null Het
Ttc28 G T 5: 110,892,856 V37F probably benign Het
Uaca C A 9: 60,880,228 Q1409K probably damaging Het
V1rd19 T A 7: 24,003,112 M1K probably null Het
Vmn1r225 A G 17: 20,502,785 R163G possibly damaging Het
Zc3h3 C A 15: 75,779,290 V694L probably damaging Het
Zfp442 G T 2: 150,409,610 T123K possibly damaging Het
Zmym1 A T 4: 127,048,658 S646T probably damaging Het
Other mutations in Myo18b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Myo18b APN 5 112874131 missense probably benign 0.05
IGL00847:Myo18b APN 5 112830389 splice site probably benign
IGL00848:Myo18b APN 5 112871485 missense probably damaging 1.00
IGL00969:Myo18b APN 5 112875007 unclassified probably benign
IGL01018:Myo18b APN 5 112809747 missense probably damaging 1.00
IGL01448:Myo18b APN 5 112811704 missense probably damaging 1.00
IGL01490:Myo18b APN 5 112809700 missense possibly damaging 0.84
IGL01556:Myo18b APN 5 112757449 splice site probably benign
IGL01637:Myo18b APN 5 112840629 missense possibly damaging 0.82
IGL01819:Myo18b APN 5 112878050 missense unknown
IGL02007:Myo18b APN 5 112874972 unclassified probably benign
IGL02146:Myo18b APN 5 112843285 missense probably damaging 1.00
IGL02229:Myo18b APN 5 112878110 missense unknown
IGL02319:Myo18b APN 5 112791139 missense probably damaging 0.99
IGL02398:Myo18b APN 5 112830312 missense possibly damaging 0.92
IGL02420:Myo18b APN 5 112827986 missense possibly damaging 0.64
IGL02626:Myo18b APN 5 112878085 missense unknown
IGL02815:Myo18b APN 5 112809735 missense probably damaging 1.00
IGL02822:Myo18b APN 5 112775345 missense probably damaging 1.00
IGL02852:Myo18b APN 5 112715511 missense probably benign 0.03
IGL02995:Myo18b APN 5 112775413 splice site probably benign
IGL03019:Myo18b APN 5 112692397 missense probably benign 0.21
IGL03039:Myo18b APN 5 112840771 missense probably damaging 1.00
IGL03112:Myo18b APN 5 112873990 missense probably benign 0.02
IGL03123:Myo18b APN 5 112874938 unclassified probably benign
IGL03288:Myo18b APN 5 112789997 missense probably damaging 1.00
IGL03391:Myo18b APN 5 112874479 unclassified probably benign
PIT4651001:Myo18b UTSW 5 112834435 missense probably benign 0.01
R0271:Myo18b UTSW 5 112809685 missense possibly damaging 0.91
R0277:Myo18b UTSW 5 112693347 splice site probably benign
R0352:Myo18b UTSW 5 112874523 unclassified probably benign
R0504:Myo18b UTSW 5 112873576 unclassified probably benign
R0539:Myo18b UTSW 5 112723868 missense probably damaging 0.99
R0599:Myo18b UTSW 5 112865750 missense probably damaging 1.00
R0627:Myo18b UTSW 5 112798834 missense probably benign 0.38
R0659:Myo18b UTSW 5 112760327 missense possibly damaging 0.66
R0671:Myo18b UTSW 5 112692766 missense probably benign 0.00
R0847:Myo18b UTSW 5 112874488 unclassified probably benign
R1082:Myo18b UTSW 5 112760414 missense probably damaging 1.00
R1116:Myo18b UTSW 5 112803279 missense probably damaging 1.00
R1264:Myo18b UTSW 5 112830319 missense probably benign 0.12
R1280:Myo18b UTSW 5 112723805 critical splice donor site probably null
R1444:Myo18b UTSW 5 112775251 critical splice donor site probably null
R1446:Myo18b UTSW 5 112757559 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1470:Myo18b UTSW 5 112693033 missense probably damaging 1.00
R1590:Myo18b UTSW 5 112875266 nonsense probably null
R1601:Myo18b UTSW 5 112871498 missense possibly damaging 0.73
R1903:Myo18b UTSW 5 112692758 missense probably damaging 1.00
R1935:Myo18b UTSW 5 112760356 missense probably benign 0.04
R1936:Myo18b UTSW 5 112760356 missense probably benign 0.04
R2008:Myo18b UTSW 5 112873557 missense probably benign
R2127:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2129:Myo18b UTSW 5 112831078 missense probably damaging 1.00
R2141:Myo18b UTSW 5 112874026 missense probably benign 0.01
R2170:Myo18b UTSW 5 112723858 missense probably benign 0.23
R2258:Myo18b UTSW 5 112874663 unclassified probably benign
R2265:Myo18b UTSW 5 112782673 missense probably damaging 1.00
R2483:Myo18b UTSW 5 112858408 missense probably damaging 1.00
R2931:Myo18b UTSW 5 112693127 missense probably benign 0.01
R3160:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3162:Myo18b UTSW 5 112692728 missense probably damaging 0.99
R3777:Myo18b UTSW 5 112757596 missense probably damaging 0.99
R4240:Myo18b UTSW 5 112803187 critical splice donor site probably null
R4243:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4245:Myo18b UTSW 5 112692395 missense possibly damaging 0.95
R4533:Myo18b UTSW 5 112693025 missense probably damaging 1.00
R4631:Myo18b UTSW 5 112846400 missense probably damaging 1.00
R4661:Myo18b UTSW 5 112875175 unclassified probably benign
R4755:Myo18b UTSW 5 112874474 nonsense probably null
R4771:Myo18b UTSW 5 112692227 nonsense probably null
R4812:Myo18b UTSW 5 112809718 missense possibly damaging 0.95
R4840:Myo18b UTSW 5 112874029 missense probably benign 0.02
R4888:Myo18b UTSW 5 112874480 unclassified probably benign
R4995:Myo18b UTSW 5 112760392 missense probably damaging 0.99
R5001:Myo18b UTSW 5 112761340 missense probably damaging 0.99
R5015:Myo18b UTSW 5 112790057 missense probably damaging 1.00
R5055:Myo18b UTSW 5 112875217 unclassified probably benign
R5070:Myo18b UTSW 5 112761346 missense probably damaging 1.00
R5105:Myo18b UTSW 5 112840778 missense probably damaging 1.00
R5121:Myo18b UTSW 5 112874480 unclassified probably benign
R5186:Myo18b UTSW 5 112871470 missense probably damaging 1.00
R5437:Myo18b UTSW 5 112757573 missense possibly damaging 0.73
R5535:Myo18b UTSW 5 112790042 missense probably damaging 1.00
R5560:Myo18b UTSW 5 112868295 missense probably damaging 0.96
R5810:Myo18b UTSW 5 112834450 missense probably damaging 1.00
R5898:Myo18b UTSW 5 112802330 intron probably null
R6065:Myo18b UTSW 5 112692781 missense probably benign 0.00
R6104:Myo18b UTSW 5 112874291 unclassified probably benign
R6113:Myo18b UTSW 5 112866385 missense probably damaging 1.00
R6158:Myo18b UTSW 5 112874172 missense probably benign 0.01
R6167:Myo18b UTSW 5 112872507 splice site probably null
R6220:Myo18b UTSW 5 112757507 missense possibly damaging 0.93
R6276:Myo18b UTSW 5 112811642 missense probably benign 0.31
R6290:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6291:Myo18b UTSW 5 112865735 missense possibly damaging 0.69
R6795:Myo18b UTSW 5 112846364 missense probably damaging 0.99
R6798:Myo18b UTSW 5 112761386 missense probably damaging 0.98
R6817:Myo18b UTSW 5 112830238 missense probably benign 0.00
R6937:Myo18b UTSW 5 112802392 missense probably benign 0.12
R7034:Myo18b UTSW 5 112723904 nonsense probably null
R7097:Myo18b UTSW 5 112874405 missense unknown
R7145:Myo18b UTSW 5 112817679 nonsense probably null
R7201:Myo18b UTSW 5 112715459 missense probably damaging 1.00
R7260:Myo18b UTSW 5 112775288 missense probably benign 0.01
R7265:Myo18b UTSW 5 112812072 missense probably damaging 1.00
Z1088:Myo18b UTSW 5 112692943 missense possibly damaging 0.89
Z1088:Myo18b UTSW 5 112757484 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GACGCGGTAACCACTAAGTAG -3'
(R):5'- TTCCTACAACGGGGATATCAGC -3'

Sequencing Primer
(F):5'- CGCGGTAACCACTAAGTAGTAATAG -3'
(R):5'- CTACAACGGGGATATCAGCAGAGG -3'
Posted On2016-06-21