Mutagenetix > Incidental Mutation

Incidental Mutation 'R5131:Cic'

395001

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

042719-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R5131 (G1)

Quality Score

128

Status

Not validated

Chromosome

Chromosomal Location

24967129-24993584 bp(+) (GRCm39)

Type of Mutation

small insertion (1 aa in frame mutation)

DNA Base Change (assembly)

TCCCCC to TCCCCCCCC at 24991095 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000005583] [ENSMUST00000108410] [ENSMUST00000148150] [ENSMUST00000155118] [ENSMUST00000163320] [ENSMUST00000169266] [ENSMUST00000164820] [ENSMUST00000165239]

AlphaFold

Q924A2

Predicted Effect

probably benign
Transcript: ENSMUST00000005578

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000005583

SMART Domains

Protein: ENSMUSP00000005583
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	12	203	3.8e-13	PFAM
Pfam:Lipase_GDSL	42	209	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108410

SMART Domains

Protein: ENSMUSP00000104048
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	4	151	1.2e-23	PFAM
low complexity region	155	166	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140093

Predicted Effect

probably benign
Transcript: ENSMUST00000148150

SMART Domains

Protein: ENSMUSP00000121250
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	43	143	5.5e-14	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148828

Predicted Effect

probably benign
Transcript: ENSMUST00000155118

SMART Domains

Protein: ENSMUSP00000120379
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	43	149	2.2e-12	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163320

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000169266

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163901

SMART Domains

Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
low complexity region	114	128	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165239

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aco1	C	T	4: 40,163,797 (GRCm39)	P17S	probably benign	Het
Arhgap35	A	G	7: 16,245,112 (GRCm39)		probably null	Het
Brd3	A	T	2: 27,343,427 (GRCm39)	N480K	probably benign	Het
Ccnk	T	C	12: 108,168,890 (GRCm39)		probably benign	Het
Cdc23	C	A	18: 34,784,742 (GRCm39)	V7L	unknown	Het
Cdh1	T	C	8: 107,390,430 (GRCm39)	V590A	possibly damaging	Het
Cert1	A	G	13: 96,751,343 (GRCm39)	D331G	probably damaging	Het
Cmklr2	T	A	1: 63,222,840 (GRCm39)	S132C	probably damaging	Het
Cyp4a12a	T	A	4: 115,185,017 (GRCm39)	D399E	possibly damaging	Het
Dnah11	A	C	12: 117,918,486 (GRCm39)	Y3482D	probably damaging	Het
Gtf3c3	A	T	1: 54,458,657 (GRCm39)		probably null	Het
Gzmk	G	T	13: 113,310,482 (GRCm39)	A73E	probably benign	Het
Hnrnpul1	A	G	7: 25,426,219 (GRCm39)	V444A	probably benign	Het
Lgr4	T	C	2: 109,842,678 (GRCm39)	S864P	probably benign	Het
Lrp2	A	T	2: 69,260,686 (GRCm39)	V4515E	possibly damaging	Het
Map3k19	A	T	1: 127,751,427 (GRCm39)	N641K	possibly damaging	Het
Mesp2	A	G	7: 79,461,475 (GRCm39)	T267A	possibly damaging	Het
Mipep	T	C	14: 61,140,823 (GRCm39)	L682P	probably damaging	Het
Nalcn	G	T	14: 123,753,182 (GRCm39)	T268K	probably damaging	Het
Ncam2	T	C	16: 81,234,550 (GRCm39)	V135A	probably benign	Het
Ndufaf6	G	T	4: 11,060,931 (GRCm39)	T215K	probably damaging	Het
Nr1h4	T	C	10: 89,319,317 (GRCm39)	D183G	probably damaging	Het
Pate9	C	T	9: 36,446,242 (GRCm39)	A57T	possibly damaging	Het
Pax2	G	T	19: 44,749,394 (GRCm39)	V41L	probably damaging	Het
Pde4dip	T	A	3: 97,616,830 (GRCm39)	N1804I	probably damaging	Het
Phtf2	A	T	5: 20,979,050 (GRCm39)	V526E	probably damaging	Het
Ppp1ca	G	A	19: 4,244,895 (GRCm39)	C291Y	probably damaging	Het
Prag1	G	T	8: 36,607,123 (GRCm39)	G955C	probably damaging	Het
Psap	T	A	10: 60,135,736 (GRCm39)	V394E	possibly damaging	Het
Rap1b	C	T	10: 117,660,516 (GRCm39)	V14I	probably damaging	Het
Rnf181	G	A	6: 72,337,811 (GRCm39)		probably null	Het
Rsbn1l	G	A	5: 21,101,243 (GRCm39)	R766C	possibly damaging	Het
Rusc2	C	T	4: 43,414,948 (GRCm39)	P85S	probably benign	Het
Rxfp1	T	C	3: 79,559,471 (GRCm39)		probably null	Het
Serpinb6a	T	A	13: 34,102,855 (GRCm39)	M202L	probably benign	Het
Snd1	T	C	6: 28,885,049 (GRCm39)	F800S	probably damaging	Het
Tbc1d2b	G	A	9: 90,091,812 (GRCm39)	T830I	probably damaging	Het
Tmem209	A	T	6: 30,497,166 (GRCm39)	N183K	probably benign	Het
Tmtc3	T	C	10: 100,284,841 (GRCm39)	D598G	probably damaging	Het
Ube3b	A	G	5: 114,545,607 (GRCm39)	D622G	probably damaging	Het
Zbtb43	A	T	2: 33,344,778 (GRCm39)	M112K	probably damaging	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	24,991,549 (GRCm39)	missense	probably damaging	1.00
IGL01668:Cic	APN	7	24,990,629 (GRCm39)	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	24,990,375 (GRCm39)	missense	probably damaging	0.96
IGL02506:Cic	APN	7	24,990,282 (GRCm39)	missense	probably benign
IGL02794:Cic	APN	7	24,985,069 (GRCm39)	missense	probably damaging	1.00
IGL03065:Cic	APN	7	24,985,246 (GRCm39)	splice site	probably benign
IGL03304:Cic	APN	7	24,984,274 (GRCm39)	missense	probably damaging	1.00
Capuccino	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
Cassock	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
Monkey	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R4850_Cic_466	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
1mM(1):Cic	UTSW	7	24,990,214 (GRCm39)	splice site	probably benign
IGL03046:Cic	UTSW	7	24,990,500 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0012:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0027:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0027:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0038:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0038:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0063:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0063:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0064:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0064:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0118:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0193:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0241:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0241:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0377:Cic	UTSW	7	24,985,224 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,565 (GRCm39)	missense	probably damaging	0.98
R0462:Cic	UTSW	7	24,986,566 (GRCm39)	missense	probably damaging	1.00
R0800:Cic	UTSW	7	24,984,662 (GRCm39)	missense	probably benign
R1253:Cic	UTSW	7	24,990,373 (GRCm39)	missense	probably damaging	1.00
R1458:Cic	UTSW	7	24,979,162 (GRCm39)	intron	probably benign
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1462:Cic	UTSW	7	24,971,032 (GRCm39)	missense	probably damaging	0.98
R1519:Cic	UTSW	7	24,993,235 (GRCm39)	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	24,985,386 (GRCm39)	missense	probably damaging	1.00
R1824:Cic	UTSW	7	24,987,691 (GRCm39)	missense	probably damaging	1.00
R1908:Cic	UTSW	7	24,986,265 (GRCm39)	missense	probably damaging	1.00
R2045:Cic	UTSW	7	24,970,961 (GRCm39)	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	24,972,876 (GRCm39)	missense	probably damaging	0.98
R2161:Cic	UTSW	7	24,987,559 (GRCm39)	splice site	probably null
R2495:Cic	UTSW	7	24,991,201 (GRCm39)	splice site	probably benign
R2865:Cic	UTSW	7	24,972,646 (GRCm39)	missense	probably damaging	0.96
R3692:Cic	UTSW	7	24,988,338 (GRCm39)	nonsense	probably null
R3709:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3710:Cic	UTSW	7	24,986,406 (GRCm39)	missense	probably damaging	0.99
R3872:Cic	UTSW	7	24,971,124 (GRCm39)	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	24,971,771 (GRCm39)	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4426:Cic	UTSW	7	24,993,433 (GRCm39)	utr 3 prime	probably benign
R4502:Cic	UTSW	7	24,987,892 (GRCm39)	missense	probably damaging	1.00
R4585:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4586:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R4614:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4664:Cic	UTSW	7	24,990,099 (GRCm39)	small deletion	probably benign
R4688:Cic	UTSW	7	24,991,095 (GRCm39)	frame shift	probably null
R4695:Cic	UTSW	7	24,973,013 (GRCm39)	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	24,987,908 (GRCm39)	missense	probably benign
R4746:Cic	UTSW	7	24,987,905 (GRCm39)	missense	probably damaging	1.00
R4758:Cic	UTSW	7	24,991,636 (GRCm39)	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	24,971,025 (GRCm39)	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	24,982,308 (GRCm39)	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	24,971,157 (GRCm39)	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4851:Cic	UTSW	7	24,972,327 (GRCm39)	missense	probably damaging	0.98
R4922:Cic	UTSW	7	24,991,095 (GRCm39)	small insertion	probably benign
R4989:Cic	UTSW	7	24,986,535 (GRCm39)	missense	probably damaging	1.00
R5718:Cic	UTSW	7	24,972,203 (GRCm39)	missense	probably benign	0.33
R5801:Cic	UTSW	7	24,970,863 (GRCm39)	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	24,971,730 (GRCm39)	missense	probably damaging	1.00
R6000:Cic	UTSW	7	24,971,423 (GRCm39)	missense	probably benign	0.33
R6246:Cic	UTSW	7	24,971,067 (GRCm39)	missense	probably damaging	1.00
R6283:Cic	UTSW	7	24,985,459 (GRCm39)	missense	probably damaging	1.00
R6364:Cic	UTSW	7	24,972,248 (GRCm39)	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	24,987,706 (GRCm39)	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	24,971,202 (GRCm39)	missense	probably benign	0.04
R6920:Cic	UTSW	7	24,990,107 (GRCm39)	missense	probably damaging	1.00
R6995:Cic	UTSW	7	24,970,736 (GRCm39)	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	24,971,621 (GRCm39)	missense	probably damaging	0.99
R7113:Cic	UTSW	7	24,972,869 (GRCm39)	missense	probably benign	0.08
R7560:Cic	UTSW	7	24,972,278 (GRCm39)	missense	probably damaging	0.98
R7680:Cic	UTSW	7	24,991,856 (GRCm39)	missense	probably damaging	0.96
R7698:Cic	UTSW	7	24,972,597 (GRCm39)	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	24,988,207 (GRCm39)	missense	probably damaging	1.00
R7841:Cic	UTSW	7	24,985,192 (GRCm39)	missense	probably damaging	1.00
R7879:Cic	UTSW	7	24,984,551 (GRCm39)	missense	probably benign	0.10
R7916:Cic	UTSW	7	24,987,715 (GRCm39)	missense	probably damaging	0.99
R7920:Cic	UTSW	7	24,971,384 (GRCm39)	missense	probably benign
R8056:Cic	UTSW	7	24,990,366 (GRCm39)	missense	possibly damaging	0.90
R8226:Cic	UTSW	7	24,987,213 (GRCm39)	missense	probably damaging	1.00
R8281:Cic	UTSW	7	24,971,249 (GRCm39)	missense	probably benign
R8847:Cic	UTSW	7	24,970,631 (GRCm39)	missense	probably damaging	0.98
R8991:Cic	UTSW	7	24,988,885 (GRCm39)	missense	probably damaging	1.00
R9083:Cic	UTSW	7	24,985,470 (GRCm39)	missense	probably damaging	0.99
R9140:Cic	UTSW	7	24,985,165 (GRCm39)	missense	probably damaging	0.99
R9200:Cic	UTSW	7	24,971,940 (GRCm39)	missense	probably damaging	0.99
R9208:Cic	UTSW	7	24,987,502 (GRCm39)	missense	probably benign	0.07
R9301:Cic	UTSW	7	24,991,117 (GRCm39)	missense	probably damaging	1.00
R9408:Cic	UTSW	7	24,971,414 (GRCm39)	missense	possibly damaging	0.70
R9569:Cic	UTSW	7	24,972,120 (GRCm39)	missense	possibly damaging	0.85
R9752:Cic	UTSW	7	24,971,403 (GRCm39)	missense	probably damaging	0.96
V7732:Cic	UTSW	7	24,991,670 (GRCm39)	missense	probably benign
Z1176:Cic	UTSW	7	24,970,444 (GRCm39)	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GCTCCCCAGAAAGTAAAGGC -3'
(R):5'- TGAAGGCCAGGATACCCAGAAC -3'

Sequencing Primer
(F):5'- CAGCCATTGCCAGCATTC -3'
(R):5'- TCTCAAGTAGAATGGAATGGGTAC -3'

Posted On

2016-06-21