Incidental Mutation 'R5131:Prag1'
ID395004
Institutional Source Beutler Lab
Gene Symbol Prag1
Ensembl Gene ENSMUSG00000050271
Gene NamePEAK1 related kinase activating pseudokinase 1
SynonymsD8Ertd82e, NACK
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.283) question?
Stock #R5131 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location36094828-36147787 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 36139969 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 955 (G955C)
Ref Sequence ENSEMBL: ENSMUSP00000106118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110492]
Predicted Effect probably damaging
Transcript: ENSMUST00000110492
AA Change: G955C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106118
Gene: ENSMUSG00000050271
AA Change: G955C

DomainStartEndE-ValueType
low complexity region 317 333 N/A INTRINSIC
low complexity region 395 412 N/A INTRINSIC
low complexity region 525 544 N/A INTRINSIC
low complexity region 781 793 N/A INTRINSIC
low complexity region 892 925 N/A INTRINSIC
Pfam:Pkinase_Tyr 1060 1288 1.7e-7 PFAM
Pfam:Pkinase 1061 1293 1.5e-13 PFAM
low complexity region 1363 1373 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that belongs to the tyrosine protein kinase family. A similar protein in rat binds to Rho family GTPase 2 (Rnd2) and regulates neurite outgrowth via activation of Ras homolog gene family, member A (RhoA). [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous disruption of this gene leads to complete embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Brd3 A T 2: 27,453,415 N480K probably benign Het
Ccnk T C 12: 108,202,631 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gm5615 C T 9: 36,534,946 A57T possibly damaging Het
Gpr1 T A 1: 63,183,681 S132C probably damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Prag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Prag1 APN 8 36099931 missense probably benign 0.01
IGL01132:Prag1 APN 8 36146357 missense probably damaging 1.00
IGL01322:Prag1 APN 8 36103934 missense probably benign 0.01
IGL01343:Prag1 APN 8 36103046 missense possibly damaging 0.95
IGL01726:Prag1 APN 8 36102992 missense probably damaging 1.00
IGL01739:Prag1 APN 8 36102680 missense probably benign 0.00
IGL02420:Prag1 APN 8 36147426 utr 3 prime probably benign
IGL02433:Prag1 APN 8 36139568 missense probably damaging 1.00
IGL02627:Prag1 APN 8 36139439 missense possibly damaging 0.93
IGL02797:Prag1 APN 8 36139501 missense probably damaging 1.00
IGL03070:Prag1 APN 8 36103549 missense probably benign 0.01
IGL03323:Prag1 APN 8 36140008 missense probably damaging 1.00
FR4340:Prag1 UTSW 8 36103886 small insertion probably benign
FR4548:Prag1 UTSW 8 36103885 small insertion probably benign
FR4589:Prag1 UTSW 8 36103883 small insertion probably benign
FR4976:Prag1 UTSW 8 36103883 small insertion probably benign
R0325:Prag1 UTSW 8 36103804 missense probably benign 0.00
R0486:Prag1 UTSW 8 36146633 missense probably damaging 1.00
R0506:Prag1 UTSW 8 36103700 missense possibly damaging 0.92
R0507:Prag1 UTSW 8 36104123 missense probably damaging 1.00
R0595:Prag1 UTSW 8 36147002 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0618:Prag1 UTSW 8 36099833 missense probably damaging 1.00
R0885:Prag1 UTSW 8 36103267 missense probably benign 0.00
R1015:Prag1 UTSW 8 36146543 missense probably damaging 1.00
R1168:Prag1 UTSW 8 36146645 missense probably damaging 1.00
R1182:Prag1 UTSW 8 36147259 missense possibly damaging 0.95
R1227:Prag1 UTSW 8 36139951 missense probably damaging 1.00
R1282:Prag1 UTSW 8 36099914 missense probably damaging 0.96
R1469:Prag1 UTSW 8 36146298 splice site probably benign
R1656:Prag1 UTSW 8 36104346 missense probably damaging 1.00
R1660:Prag1 UTSW 8 36140023 missense possibly damaging 0.73
R1676:Prag1 UTSW 8 36102898 missense probably damaging 0.96
R1820:Prag1 UTSW 8 36103804 missense probably benign 0.00
R1970:Prag1 UTSW 8 36129160 splice site probably null
R1974:Prag1 UTSW 8 36102927 missense probably damaging 1.00
R4398:Prag1 UTSW 8 36103655 missense probably damaging 1.00
R4429:Prag1 UTSW 8 36146642 missense probably damaging 1.00
R4627:Prag1 UTSW 8 36103292 missense probably damaging 1.00
R4980:Prag1 UTSW 8 36139586 missense probably damaging 1.00
R5215:Prag1 UTSW 8 36099889 missense probably benign 0.06
R5346:Prag1 UTSW 8 36103685 missense probably damaging 1.00
R5414:Prag1 UTSW 8 36139622 missense probably benign 0.00
R5535:Prag1 UTSW 8 36104014 missense probably benign
R5687:Prag1 UTSW 8 36146813 missense probably benign 0.02
R5785:Prag1 UTSW 8 36103487 missense probably benign 0.35
R5817:Prag1 UTSW 8 36103703 missense probably damaging 1.00
R6002:Prag1 UTSW 8 36104183 missense probably benign 0.31
R6127:Prag1 UTSW 8 36147401 missense unknown
R6240:Prag1 UTSW 8 36103352 missense probably benign 0.03
R6277:Prag1 UTSW 8 36146591 missense probably damaging 1.00
R6326:Prag1 UTSW 8 36102706 missense possibly damaging 0.79
R6741:Prag1 UTSW 8 36147280 missense probably benign 0.41
R6925:Prag1 UTSW 8 36103894 missense probably damaging 1.00
R7085:Prag1 UTSW 8 36104237 missense possibly damaging 0.71
R7095:Prag1 UTSW 8 36102560 missense probably benign
R7204:Prag1 UTSW 8 36146761 missense probably benign 0.03
R7213:Prag1 UTSW 8 36146615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACGTCATCATCCCAGCTCAG -3'
(R):5'- GAATTTCACGGCGCTACTTCC -3'

Sequencing Primer
(F):5'- ATCCCAGCTCAGCGTGTC -3'
(R):5'- GCTAAGTAGCCCGCCAAAACTTG -3'
Posted On2016-06-21