Incidental Mutation 'R5131:Gm5615'
ID395007
Institutional Source Beutler Lab
Gene Symbol Gm5615
Ensembl Gene ENSMUSG00000074448
Gene Namepredicted gene 5615
Synonyms
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R5131 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location36532397-36541963 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 36534946 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 57 (A57T)
Ref Sequence ENSEMBL: ENSMUSP00000096499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098900
AA Change: A57T

PolyPhen 2 Score 0.574 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096499
Gene: ENSMUSG00000074448
AA Change: A57T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183745
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Brd3 A T 2: 27,453,415 N480K probably benign Het
Ccnk T C 12: 108,202,631 probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gpr1 T A 1: 63,183,681 S132C probably damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Prag1 G T 8: 36,139,969 G955C probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Gm5615
AlleleSourceChrCoordTypePredicted EffectPPH Score
LCD18:Gm5615 UTSW 9 36533553 utr 3 prime probably benign
PIT1430001:Gm5615 UTSW 9 36534999 nonsense probably null
R1647:Gm5615 UTSW 9 36534440 missense possibly damaging 0.90
R6440:Gm5615 UTSW 9 36541872 start codon destroyed probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TCTAGGTTTGTTCCTATGCCAG -3'
(R):5'- GCGTTCAGCTATTCACACAG -3'

Sequencing Primer
(F):5'- TGCCAGTTGTAGCTAGTAGAAAC -3'
(R):5'- GCGTTCAGCTATTCACACAGTAAAC -3'
Posted On2016-06-21