Incidental Mutation 'R5131:Ccnk'
ID395014
Institutional Source Beutler Lab
Gene Symbol Ccnk
Ensembl Gene ENSMUSG00000021258
Gene Namecyclin K
SynonymsCycK, CPR4
MMRRC Submission 042719-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5131 (G1)
Quality Score194
Status Not validated
Chromosome12
Chromosomal Location108179579-108203359 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 108202631 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152421 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101055] [ENSMUST00000136175] [ENSMUST00000221167] [ENSMUST00000222310]
Predicted Effect unknown
Transcript: ENSMUST00000101055
AA Change: V560A
SMART Domains Protein: ENSMUSP00000098616
Gene: ENSMUSG00000021258
AA Change: V560A

DomainStartEndE-ValueType
CYCLIN 55 149 6.67e-16 SMART
Cyclin_C 158 278 4.83e-1 SMART
CYCLIN 162 256 1.23e-1 SMART
low complexity region 342 361 N/A INTRINSIC
low complexity region 365 392 N/A INTRINSIC
low complexity region 404 427 N/A INTRINSIC
low complexity region 428 446 N/A INTRINSIC
low complexity region 457 471 N/A INTRINSIC
low complexity region 476 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136175
SMART Domains Protein: ENSMUSP00000125757
Gene: ENSMUSG00000084883

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Pfam:DUF2216 16 220 6.9e-99 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000221167
AA Change: V560A
Predicted Effect probably benign
Transcript: ENSMUST00000222310
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223363
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transcription cyclin family. These cyclins may regulate transcription through their association with and activation of cyclin-dependent kinases (CDK) that phosphorylate the C-terminal domain (CTD) of the large subunit of RNA polymerase II. This gene product may play a dual role in regulating CDK and RNA polymerase II activities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display complete embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aco1 C T 4: 40,163,797 P17S probably benign Het
Arhgap35 A G 7: 16,511,187 probably null Het
Brd3 A T 2: 27,453,415 N480K probably benign Het
Cdc23 C A 18: 34,651,689 V7L unknown Het
Cdh1 T C 8: 106,663,798 V590A possibly damaging Het
Cic TCCCCC TCCCCCCCC 7: 25,291,670 probably benign Het
Col4a3bp A G 13: 96,614,835 D331G probably damaging Het
Cyp4a12a T A 4: 115,327,820 D399E possibly damaging Het
Dnah11 A C 12: 117,954,751 Y3482D probably damaging Het
Gm5615 C T 9: 36,534,946 A57T possibly damaging Het
Gpr1 T A 1: 63,183,681 S132C probably damaging Het
Gtf3c3 A T 1: 54,419,498 probably null Het
Gzmk G T 13: 113,173,948 A73E probably benign Het
Hnrnpul1 A G 7: 25,726,794 V444A probably benign Het
Lgr4 T C 2: 110,012,333 S864P probably benign Het
Lrp2 A T 2: 69,430,342 V4515E possibly damaging Het
Map3k19 A T 1: 127,823,690 N641K possibly damaging Het
Mesp2 A G 7: 79,811,727 T267A possibly damaging Het
Mipep T C 14: 60,903,374 L682P probably damaging Het
Nalcn G T 14: 123,515,770 T268K probably damaging Het
Ncam2 T C 16: 81,437,662 V135A probably benign Het
Ndufaf6 G T 4: 11,060,931 T215K probably damaging Het
Nr1h4 T C 10: 89,483,455 D183G probably damaging Het
Pax2 G T 19: 44,760,955 V41L probably damaging Het
Pde4dip T A 3: 97,709,514 N1804I probably damaging Het
Phtf2 A T 5: 20,774,052 V526E probably damaging Het
Ppp1ca G A 19: 4,194,896 C291Y probably damaging Het
Prag1 G T 8: 36,139,969 G955C probably damaging Het
Psap T A 10: 60,299,957 V394E possibly damaging Het
Rap1b C T 10: 117,824,611 V14I probably damaging Het
Rnf181 G A 6: 72,360,828 probably null Het
Rsbn1l G A 5: 20,896,245 R766C possibly damaging Het
Rusc2 C T 4: 43,414,948 P85S probably benign Het
Rxfp1 T C 3: 79,652,164 probably null Het
Serpinb6a T A 13: 33,918,872 M202L probably benign Het
Snd1 T C 6: 28,885,050 F800S probably damaging Het
Tbc1d2b G A 9: 90,209,759 T830I probably damaging Het
Tmem209 A T 6: 30,497,167 N183K probably benign Het
Tmtc3 T C 10: 100,448,979 D598G probably damaging Het
Ube3b A G 5: 114,407,546 D622G probably damaging Het
Zbtb43 A T 2: 33,454,766 M112K probably damaging Het
Other mutations in Ccnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02331:Ccnk APN 12 108189084 missense probably damaging 1.00
IGL02341:Ccnk APN 12 108195730 missense unknown
IGL02557:Ccnk APN 12 108195726 missense unknown
FR4449:Ccnk UTSW 12 108202507 unclassified probably benign
FR4737:Ccnk UTSW 12 108202507 unclassified probably benign
FR4976:Ccnk UTSW 12 108202507 unclassified probably benign
R0481:Ccnk UTSW 12 108199309 unclassified probably benign
R0725:Ccnk UTSW 12 108195575 splice site probably benign
R1839:Ccnk UTSW 12 108195074 missense probably damaging 1.00
R2144:Ccnk UTSW 12 108189090 missense probably null 1.00
R2903:Ccnk UTSW 12 108202388 unclassified probably benign
R4660:Ccnk UTSW 12 108202316 unclassified probably benign
R5404:Ccnk UTSW 12 108195623 missense possibly damaging 0.88
R5843:Ccnk UTSW 12 108193730 missense probably damaging 1.00
R5860:Ccnk UTSW 12 108187207 missense probably damaging 0.99
R6522:Ccnk UTSW 12 108187187 missense probably damaging 0.99
R6864:Ccnk UTSW 12 108202214 unclassified probably benign
R7135:Ccnk UTSW 12 108186475 missense probably damaging 0.96
R7179:Ccnk UTSW 12 108187258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCAGTCCATGATGAAGACG -3'
(R):5'- ACTGTCTAGCATATACAAGGCG -3'

Sequencing Primer
(F):5'- AGGGCCCCTCCTATGGTG -3'
(R):5'- ATATACAAGGCGCCCTGCTG -3'
Posted On2016-06-21