Incidental Mutation 'R5144:Ncor1'
ID395057
Institutional Source Beutler Lab
Gene Symbol Ncor1
Ensembl Gene ENSMUSG00000018501
Gene Namenuclear receptor co-repressor 1
Synonyms5730405M06Rik, A230020K14Rik, Rxrip13, N-CoR
MMRRC Submission 042728-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5144 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location62316426-62458541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 62349464 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 894 (S894R)
Ref Sequence ENSEMBL: ENSMUSP00000125317 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018645] [ENSMUST00000037575] [ENSMUST00000101066] [ENSMUST00000101067] [ENSMUST00000151498] [ENSMUST00000155712]
Predicted Effect probably damaging
Transcript: ENSMUST00000018645
AA Change: S1246R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000018645
Gene: ENSMUSG00000018501
AA Change: S1246R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
Pfam:GPS2_interact 150 239 1.4e-37 PFAM
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000037575
SMART Domains Protein: ENSMUSP00000038900
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 28 41 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
coiled coil region 658 695 N/A INTRINSIC
low complexity region 780 794 N/A INTRINSIC
low complexity region 915 926 N/A INTRINSIC
low complexity region 982 1001 N/A INTRINSIC
PDB:3N00|B 1010 1030 2e-7 PDB
low complexity region 1032 1047 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
PDB:2OVM|B 1212 1235 2e-8 PDB
low complexity region 1256 1269 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101066
AA Change: S1246R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098627
Gene: ENSMUSG00000018501
AA Change: S1246R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 710 731 N/A INTRINSIC
low complexity region 771 788 N/A INTRINSIC
low complexity region 888 899 N/A INTRINSIC
low complexity region 987 995 N/A INTRINSIC
low complexity region 1002 1013 N/A INTRINSIC
low complexity region 1036 1049 N/A INTRINSIC
internal_repeat_2 1061 1298 1.62e-6 PROSPERO
internal_repeat_2 1299 1515 1.62e-6 PROSPERO
low complexity region 1516 1527 N/A INTRINSIC
coiled coil region 1712 1749 N/A INTRINSIC
low complexity region 1834 1848 N/A INTRINSIC
low complexity region 1969 1980 N/A INTRINSIC
low complexity region 2036 2055 N/A INTRINSIC
PDB:3N00|B 2064 2084 4e-7 PDB
low complexity region 2086 2101 N/A INTRINSIC
low complexity region 2157 2168 N/A INTRINSIC
PDB:2OVM|B 2267 2290 2e-8 PDB
low complexity region 2311 2324 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101067
AA Change: S1192R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000098628
Gene: ENSMUSG00000018501
AA Change: S1192R

DomainStartEndE-ValueType
low complexity region 51 74 N/A INTRINSIC
coiled coil region 176 217 N/A INTRINSIC
coiled coil region 302 329 N/A INTRINSIC
low complexity region 349 366 N/A INTRINSIC
SANT 437 485 2.76e-7 SMART
coiled coil region 507 544 N/A INTRINSIC
low complexity region 593 617 N/A INTRINSIC
SANT 624 672 3.29e-14 SMART
low complexity region 716 734 N/A INTRINSIC
low complexity region 838 849 N/A INTRINSIC
low complexity region 937 945 N/A INTRINSIC
low complexity region 952 963 N/A INTRINSIC
low complexity region 986 999 N/A INTRINSIC
low complexity region 1448 1459 N/A INTRINSIC
coiled coil region 1645 1682 N/A INTRINSIC
low complexity region 1767 1781 N/A INTRINSIC
low complexity region 1902 1913 N/A INTRINSIC
low complexity region 1969 1988 N/A INTRINSIC
PDB:3N00|B 1997 2017 4e-7 PDB
low complexity region 2019 2034 N/A INTRINSIC
low complexity region 2089 2100 N/A INTRINSIC
PDB:2OVM|B 2199 2222 2e-8 PDB
low complexity region 2243 2256 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000151498
AA Change: S894R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125317
Gene: ENSMUSG00000018501
AA Change: S894R

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000155712
SMART Domains Protein: ENSMUSP00000122654
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 26 47 N/A INTRINSIC
low complexity region 87 104 N/A INTRINSIC
low complexity region 204 215 N/A INTRINSIC
low complexity region 303 311 N/A INTRINSIC
low complexity region 318 329 N/A INTRINSIC
low complexity region 352 365 N/A INTRINSIC
low complexity region 785 796 N/A INTRINSIC
coiled coil region 982 1019 N/A INTRINSIC
low complexity region 1104 1118 N/A INTRINSIC
low complexity region 1239 1250 N/A INTRINSIC
low complexity region 1306 1325 N/A INTRINSIC
PDB:3N00|B 1334 1354 3e-7 PDB
low complexity region 1356 1371 N/A INTRINSIC
low complexity region 1427 1438 N/A INTRINSIC
PDB:2OVM|B 1537 1560 2e-8 PDB
low complexity region 1581 1594 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156740
SMART Domains Protein: ENSMUSP00000125458
Gene: ENSMUSG00000018501

DomainStartEndE-ValueType
low complexity region 18 31 N/A INTRINSIC
low complexity region 451 462 N/A INTRINSIC
coiled coil region 647 684 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
low complexity region 905 916 N/A INTRINSIC
low complexity region 972 991 N/A INTRINSIC
PDB:3N00|B 1000 1020 2e-7 PDB
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1092 1103 N/A INTRINSIC
PDB:2OVM|B 1202 1225 2e-8 PDB
low complexity region 1246 1259 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159069
AA Change: S894R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000124761
Gene: ENSMUSG00000018501
AA Change: S894R

DomainStartEndE-ValueType
SANT 37 85 2.76e-7 SMART
coiled coil region 107 144 N/A INTRINSIC
low complexity region 193 217 N/A INTRINSIC
SANT 224 272 3.29e-14 SMART
low complexity region 316 337 N/A INTRINSIC
low complexity region 361 378 N/A INTRINSIC
low complexity region 478 489 N/A INTRINSIC
low complexity region 577 585 N/A INTRINSIC
low complexity region 592 603 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
internal_repeat_2 700 830 5.77e-7 PROSPERO
internal_repeat_2 855 961 5.77e-7 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159224
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161116
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161432
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that mediates ligand-independent transcription repression of thyroid-hormone and retinoic-acid receptors by promoting chromatin condensation and preventing access of the transcription machinery. It is part of a complex which also includes histone deacetylases and transcriptional regulators similar to the yeast protein Sin3p. This gene is located between the Charcot-Marie-Tooth and Smith-Magenis syndrome critical regions on chromosome 17. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 17 and 20.[provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted mutation in this gene exhibit embryonic lethality with erythrocytic, thymocytic and central nervous system development abnormalities. Mice homozygous for a hypomorphic allele exhibit increased thyroid hormone sensitivity under hypothyroid conditions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930415O20Rik C A 15: 98,585,267 probably null Het
4933409G03Rik T A 2: 68,616,260 probably benign Het
Arpc2 A T 1: 74,248,208 K62N probably damaging Het
B4galt5 C T 2: 167,306,596 E201K possibly damaging Het
Bub1b C T 2: 118,615,499 T334M possibly damaging Het
Ccdc71 T C 9: 108,463,852 V288A probably benign Het
Cep350 G A 1: 155,911,150 R1444W probably damaging Het
Chrna4 A G 2: 181,024,830 L605P probably damaging Het
Col6a5 T A 9: 105,889,283 I1813F probably damaging Het
Col9a1 A G 1: 24,239,353 I821V probably benign Het
D430041D05Rik T C 2: 104,258,502 D43G probably damaging Het
Depdc7 T C 2: 104,730,253 Y132C probably damaging Het
Dppa2 T C 16: 48,317,303 V216A probably damaging Het
Ect2l A T 10: 18,144,577 N598K probably benign Het
Eif3c T C 7: 126,563,066 T195A probably benign Het
Epg5 T C 18: 78,015,680 V1883A probably damaging Het
Ino80c T A 18: 24,108,878 D150V probably benign Het
Kcnb1 T A 2: 167,105,944 Y328F probably damaging Het
Kcnj3 G A 2: 55,447,047 probably null Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Nod2 T C 8: 88,653,066 V72A probably damaging Het
Nudt19 T C 7: 35,555,225 T194A probably benign Het
Olfr350 A T 2: 36,850,144 T33S probably benign Het
Olfr920 C T 9: 38,756,393 S235L possibly damaging Het
Pappa2 T A 1: 158,957,133 R102S probably benign Het
Pik3c2a T C 7: 116,350,786 N1332S probably benign Het
Plppr1 T A 4: 49,319,800 V142E possibly damaging Het
Prdm6 C A 18: 53,465,038 probably benign Het
Prm2 T A 16: 10,791,868 probably benign Het
Prmt3 T C 7: 49,786,135 S155P possibly damaging Het
Rars2 T C 4: 34,656,793 Y481H probably benign Het
Rgs2 G A 1: 144,001,699 T206M probably benign Het
Slc2a8 C T 2: 32,981,773 R56H probably damaging Het
Stk35 T A 2: 129,810,935 M452K probably damaging Het
Tcf3 G A 10: 80,415,237 H454Y probably damaging Het
Tgm3 C T 2: 130,048,282 S655F possibly damaging Het
Tssc4 T G 7: 143,070,033 L26R probably damaging Het
Utp11 A T 4: 124,678,902 probably benign Het
Vmn1r237 C G 17: 21,314,426 A137G possibly damaging Het
Vmn2r-ps159 G T 4: 156,334,397 noncoding transcript Het
Vps8 T C 16: 21,559,353 L1038P probably damaging Het
Wipf3 C T 6: 54,485,675 A290V probably damaging Het
Zdhhc25 T G 15: 88,601,056 L198R probably damaging Het
Zdhhc6 A T 19: 55,314,566 M1K probably null Het
Other mutations in Ncor1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Ncor1 APN 11 62392528 missense probably damaging 1.00
IGL01343:Ncor1 APN 11 62325486 critical splice donor site probably null
IGL01392:Ncor1 APN 11 62340594 missense probably damaging 0.99
IGL01402:Ncor1 APN 11 62340474 missense probably damaging 1.00
IGL01714:Ncor1 APN 11 62334584 missense possibly damaging 0.58
IGL01772:Ncor1 APN 11 62349347 intron probably benign
IGL01889:Ncor1 APN 11 62334601 missense possibly damaging 0.69
IGL02058:Ncor1 APN 11 62344637 missense probably damaging 1.00
IGL02065:Ncor1 APN 11 62419609 missense possibly damaging 0.95
IGL02073:Ncor1 APN 11 62358917 missense probably damaging 0.99
IGL02176:Ncor1 APN 11 62329659 unclassified probably benign
IGL02288:Ncor1 APN 11 62349403 missense probably benign 0.01
IGL02348:Ncor1 APN 11 62333659 splice site probably benign
IGL02608:Ncor1 APN 11 62373214 missense probably benign 0.07
LCD18:Ncor1 UTSW 11 62419782 critical splice acceptor site probably benign
R0026:Ncor1 UTSW 11 62438429 missense probably damaging 1.00
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0038:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0103:Ncor1 UTSW 11 62343045 missense possibly damaging 0.85
R0144:Ncor1 UTSW 11 62392595 missense probably damaging 1.00
R0427:Ncor1 UTSW 11 62410920 missense probably damaging 1.00
R0501:Ncor1 UTSW 11 62373322 missense possibly damaging 0.73
R0544:Ncor1 UTSW 11 62333776 missense probably damaging 1.00
R0544:Ncor1 UTSW 11 62333777 missense probably damaging 1.00
R0563:Ncor1 UTSW 11 62343230 missense probably damaging 0.97
R1074:Ncor1 UTSW 11 62392551 missense probably damaging 0.99
R1266:Ncor1 UTSW 11 62334040 missense probably damaging 0.98
R1444:Ncor1 UTSW 11 62403806 missense probably damaging 1.00
R1452:Ncor1 UTSW 11 62334631 missense probably damaging 1.00
R1534:Ncor1 UTSW 11 62378504 missense possibly damaging 0.92
R1710:Ncor1 UTSW 11 62423005 missense probably damaging 1.00
R1762:Ncor1 UTSW 11 62384784 missense possibly damaging 0.82
R1771:Ncor1 UTSW 11 62327112 missense probably damaging 1.00
R1864:Ncor1 UTSW 11 62381419 missense probably damaging 1.00
R1902:Ncor1 UTSW 11 62338158 missense probably damaging 1.00
R1906:Ncor1 UTSW 11 62349385 missense possibly damaging 0.81
R2009:Ncor1 UTSW 11 62325601 missense probably benign 0.43
R3708:Ncor1 UTSW 11 62344687 missense probably damaging 1.00
R3825:Ncor1 UTSW 11 62373357 missense probably benign 0.00
R3923:Ncor1 UTSW 11 62325616 missense probably damaging 1.00
R3966:Ncor1 UTSW 11 62344757 missense probably damaging 1.00
R4049:Ncor1 UTSW 11 62329668 intron probably null
R4350:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4351:Ncor1 UTSW 11 62410818 critical splice donor site probably null
R4359:Ncor1 UTSW 11 62358910 missense probably damaging 1.00
R4712:Ncor1 UTSW 11 62344834 missense probably damaging 1.00
R4723:Ncor1 UTSW 11 62378612 missense probably benign 0.26
R4863:Ncor1 UTSW 11 62392638 missense possibly damaging 0.92
R4875:Ncor1 UTSW 11 62433611 small deletion probably benign
R4956:Ncor1 UTSW 11 62340605 missense probably damaging 1.00
R4993:Ncor1 UTSW 11 62343341 missense probably damaging 1.00
R5079:Ncor1 UTSW 11 62345237 missense possibly damaging 0.92
R5223:Ncor1 UTSW 11 62339000 missense probably damaging 1.00
R5243:Ncor1 UTSW 11 62338962 missense probably damaging 1.00
R5271:Ncor1 UTSW 11 62340545 missense probably damaging 1.00
R5285:Ncor1 UTSW 11 62392649 missense probably damaging 1.00
R5533:Ncor1 UTSW 11 62343011 missense probably benign 0.00
R5580:Ncor1 UTSW 11 62389778 nonsense probably null
R5593:Ncor1 UTSW 11 62369304 missense probably damaging 1.00
R5609:Ncor1 UTSW 11 62358853 unclassified probably null
R5632:Ncor1 UTSW 11 62338234 missense possibly damaging 0.85
R5830:Ncor1 UTSW 11 62344763 missense possibly damaging 0.71
R5896:Ncor1 UTSW 11 62383190 missense probably damaging 1.00
R5973:Ncor1 UTSW 11 62349310 intron probably null
R6013:Ncor1 UTSW 11 62321077 missense probably benign
R6019:Ncor1 UTSW 11 62373161 missense probably benign 0.00
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6032:Ncor1 UTSW 11 62373321 missense possibly damaging 0.54
R6075:Ncor1 UTSW 11 62317849 missense probably damaging 1.00
R6091:Ncor1 UTSW 11 62419617 missense probably damaging 0.98
R6248:Ncor1 UTSW 11 62366982 missense probably damaging 1.00
R6281:Ncor1 UTSW 11 62373545 missense possibly damaging 0.71
R6351:Ncor1 UTSW 11 62373298 missense probably benign 0.30
R6469:Ncor1 UTSW 11 62343302 missense probably damaging 1.00
R6502:Ncor1 UTSW 11 62381414 nonsense probably null
R6614:Ncor1 UTSW 11 62330819 missense probably benign 0.01
R6650:Ncor1 UTSW 11 62334541 missense probably damaging 1.00
R6765:Ncor1 UTSW 11 62373446 missense probably benign 0.01
R6852:Ncor1 UTSW 11 62343245 missense probably damaging 0.97
R6909:Ncor1 UTSW 11 62329486 missense probably damaging 1.00
R6965:Ncor1 UTSW 11 62353233 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62354569 critical splice donor site probably null
X0065:Ncor1 UTSW 11 62358991 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- GCCAGTGATTAAGCCCAATATGAC -3'
(R):5'- GGGCGCTGTCTACACAAATATG -3'

Sequencing Primer
(F):5'- GTGATTAAGCCCAATATGACAGCAC -3'
(R):5'- TGACCTATTTAGACCAGGCTAGC -3'
Posted On2016-06-21