Incidental Mutation 'R5145:Cry2'
ID395071
Institutional Source Beutler Lab
Gene Symbol Cry2
Ensembl Gene ENSMUSG00000068742
Gene Namecryptochrome 2 (photolyase-like)
Synonyms
MMRRC Submission 042729-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R5145 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location92403646-92434043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92413060 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 479 (I479V)
Ref Sequence ENSEMBL: ENSMUSP00000106909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090559] [ENSMUST00000111278]
Predicted Effect probably benign
Transcript: ENSMUST00000090559
AA Change: I479V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088047
Gene: ENSMUSG00000068742
AA Change: I479V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 187 2.4e-50 PFAM
Pfam:FAD_binding_7 231 504 4.4e-89 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111278
AA Change: I479V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106909
Gene: ENSMUSG00000068742
AA Change: I479V

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:DNA_photolyase 23 189 3.6e-50 PFAM
Pfam:FAD_binding_7 230 506 1.4e-105 PFAM
low complexity region 562 573 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126002
Meta Mutation Damage Score 0.092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (37/37)
MGI Phenotype FUNCTION: This gene encodes a flavin adenine dinucleotide-binding protein that is a key component of the circadian core oscillator complex, which regulates the circadian clock. This gene is upregulated by Clock/Arntl heterodimers but then represses this upregulation in a feedback loop using Per/Cry heterodimers to interact with Clock/Arntl. Polymorphisms in this gene have been associated with altered sleep patterns. The encoded protein is widely conserved across plants and animals. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a one-hour longer circadian period under constant darkness, and reduced expression of another circadian gene in the suprachiasmatic nucleus in response to acute light exposure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts12 G A 15: 11,285,876 G724R probably damaging Het
Adgrg7 T A 16: 56,742,319 I552L probably benign Het
Ankrd11 A G 8: 122,891,204 probably benign Het
Col12a1 T C 9: 79,706,300 T88A probably benign Het
Col6a5 T G 9: 105,934,245 I692L unknown Het
Ddx21 T C 10: 62,587,539 probably null Het
Efcab12 T A 6: 115,823,277 I262F probably damaging Het
Eif2ak2 T C 17: 78,876,204 D72G possibly damaging Het
Fry T C 5: 150,370,224 F461L probably damaging Het
Gm38706 G A 6: 130,483,768 noncoding transcript Het
Gm9772 C T 17: 22,007,126 C59Y probably damaging Het
Meig1 T C 2: 3,409,226 E79G probably damaging Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Mfsd2b T A 12: 4,865,908 probably benign Het
Nfatc2 A C 2: 168,590,067 I42S probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Npy6r C T 18: 44,276,619 T369I probably benign Het
Olfr1352 A G 10: 78,984,309 E173G probably benign Het
Ptprb A G 10: 116,343,915 T1413A probably benign Het
Ptprc A G 1: 138,089,566 S624P probably benign Het
Pum3 A G 19: 27,399,769 V441A probably damaging Het
Ranbp2 T A 10: 58,480,038 D2193E probably damaging Het
Rbl1 A T 2: 157,175,477 probably benign Het
Rnf167 T C 11: 70,650,080 probably benign Het
Sdr9c7 T C 10: 127,902,390 V179A probably damaging Het
Sema3c A G 5: 17,727,617 N706S possibly damaging Het
Stt3a T C 9: 36,735,466 Y617C probably damaging Het
Tdrd6 T A 17: 43,626,075 S1361C probably damaging Het
Tha1 A C 11: 117,869,676 S241A probably damaging Het
Tti1 G A 2: 158,008,512 A269V probably benign Het
Ugt2a1 A G 5: 87,486,027 probably null Het
Vmn2r10 T C 5: 108,995,895 T730A possibly damaging Het
Other mutations in Cry2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01995:Cry2 APN 2 92424632 missense probably benign 0.15
IGL02167:Cry2 APN 2 92433821 missense possibly damaging 0.93
IGL02183:Cry2 APN 2 92413039 missense probably damaging 0.99
IGL02343:Cry2 APN 2 92426921 missense possibly damaging 0.90
IGL02432:Cry2 APN 2 92413667 missense probably damaging 0.99
IGL02725:Cry2 APN 2 92413260 splice site probably benign
IGL02932:Cry2 APN 2 92413117 nonsense probably null
IGL03122:Cry2 APN 2 92413295 missense probably damaging 1.00
IGL03366:Cry2 APN 2 92413715 missense probably damaging 1.00
R0679:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R1325:Cry2 UTSW 2 92413770 missense probably damaging 1.00
R1862:Cry2 UTSW 2 92424566 missense probably damaging 1.00
R1891:Cry2 UTSW 2 92413640 missense possibly damaging 0.93
R2189:Cry2 UTSW 2 92411692 missense possibly damaging 0.84
R4032:Cry2 UTSW 2 92413827 missense probably benign 0.00
R4689:Cry2 UTSW 2 92424554 missense probably benign 0.38
R5130:Cry2 UTSW 2 92424599 missense probably benign 0.28
R5970:Cry2 UTSW 2 92412967 missense probably benign 0.08
R6179:Cry2 UTSW 2 92413842 missense probably damaging 0.98
R7102:Cry2 UTSW 2 92413093 missense probably damaging 0.99
R7158:Cry2 UTSW 2 92413715 missense probably damaging 1.00
R7213:Cry2 UTSW 2 92413659 missense probably benign 0.00
R7257:Cry2 UTSW 2 92412981 missense possibly damaging 0.67
R7378:Cry2 UTSW 2 92413664 missense probably damaging 1.00
R7427:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7428:Cry2 UTSW 2 92413047 missense possibly damaging 0.74
R7440:Cry2 UTSW 2 92413638 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGCATCTTTTACAGCCTGGGG -3'
(R):5'- CAGACTCTTTGGCTCTGGAG -3'

Sequencing Primer
(F):5'- GCCAACACCTGAAAAAGCTTTC -3'
(R):5'- AGCCTCCCTCCTGGATTGG -3'
Posted On2016-06-21