Incidental Mutation 'R5146:Zfp873'
ID395118
Institutional Source Beutler Lab
Gene Symbol Zfp873
Ensembl Gene ENSMUSG00000061371
Gene Namezinc finger protein 873
Synonyms
MMRRC Submission 042730-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R5146 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location82048123-82064745 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 82060224 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 300 (Y300C)
Ref Sequence ENSEMBL: ENSMUSP00000148219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105313] [ENSMUST00000209622] [ENSMUST00000210325]
Predicted Effect probably damaging
Transcript: ENSMUST00000105313
AA Change: Y263C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000100950
Gene: ENSMUSG00000061371
AA Change: Y263C

DomainStartEndE-ValueType
ZnF_C2H2 68 90 1.12e2 SMART
ZnF_C2H2 96 117 4.69e0 SMART
ZnF_C2H2 123 145 2.06e1 SMART
ZnF_C2H2 151 173 5.5e-3 SMART
ZnF_C2H2 179 201 3.69e-4 SMART
ZnF_C2H2 207 229 3.89e-3 SMART
ZnF_C2H2 235 257 9.88e-5 SMART
ZnF_C2H2 263 285 5.59e-4 SMART
ZnF_C2H2 291 313 2.99e-4 SMART
ZnF_C2H2 319 341 1.95e-3 SMART
ZnF_C2H2 347 369 2.75e-3 SMART
ZnF_C2H2 375 397 7.37e-4 SMART
ZnF_C2H2 403 425 2.53e-2 SMART
ZnF_C2H2 431 453 9.08e-4 SMART
ZnF_C2H2 459 481 5.99e-4 SMART
ZnF_C2H2 487 509 1.22e-4 SMART
ZnF_C2H2 515 537 1.82e-3 SMART
ZnF_C2H2 543 565 2.53e-2 SMART
ZnF_C2H2 571 593 9.73e-4 SMART
ZnF_C2H2 599 619 3.13e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209614
Predicted Effect probably benign
Transcript: ENSMUST00000209622
Predicted Effect probably damaging
Transcript: ENSMUST00000210325
AA Change: Y300C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219748
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency 97% (35/36)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik A G 12: 71,243,025 D1498G possibly damaging Het
Adcyap1r1 A G 6: 55,484,972 I329V probably benign Het
Ahnak2 A C 12: 112,775,726 H637Q probably benign Het
Carmil3 A G 14: 55,497,179 D455G probably benign Het
Cdh7 A G 1: 109,994,312 T45A probably damaging Het
Chil4 T A 3: 106,202,834 T315S probably benign Het
Cntnap5c T C 17: 58,013,847 V138A probably damaging Het
Csmd1 T C 8: 16,196,190 D1065G probably damaging Het
Cspp1 C T 1: 10,074,876 R296* probably null Het
Dnah17 A G 11: 118,114,179 M793T probably damaging Het
Dock4 A G 12: 40,649,492 probably null Het
Fgfr4 G T 13: 55,165,912 L511F probably damaging Het
Gm14415 T C 2: 177,104,231 noncoding transcript Het
Gm7030 A G 17: 36,129,015 W76R probably damaging Het
Gpam A G 19: 55,093,946 V91A probably damaging Het
Grin2b T A 6: 135,779,342 I462F probably damaging Het
Grwd1 A T 7: 45,827,834 F210I probably damaging Het
Itfg1 T C 8: 85,718,868 *611W probably null Het
Kcna2 T C 3: 107,105,498 V465A probably benign Het
Mfng C T 15: 78,764,388 R163H probably benign Het
Myo15b A G 11: 115,891,198 T1444A probably benign Het
Nlgn3 G A X: 101,318,285 V287I probably benign Het
Oas1c A G 5: 120,802,094 S336P probably benign Het
Pirb T C 7: 3,712,621 probably benign Het
Pot1b A T 17: 55,672,865 Y330* probably null Het
Rnf20 A T 4: 49,651,456 M641L probably benign Het
Sppl2b T C 10: 80,867,640 *579Q probably null Het
Sumf1 G A 6: 108,185,310 P83S probably benign Het
Tmem101 C T 11: 102,154,624 R133Q probably benign Het
Ttn G A 2: 76,870,363 probably benign Het
Vmn2r84 A G 10: 130,386,102 Y750H probably damaging Het
Other mutations in Zfp873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02250:Zfp873 APN 10 82058418 start codon destroyed probably null 0.45
R0666:Zfp873 UTSW 10 82060761 missense possibly damaging 0.75
R1568:Zfp873 UTSW 10 82060279 missense probably damaging 1.00
R1739:Zfp873 UTSW 10 82060707 missense probably damaging 1.00
R1848:Zfp873 UTSW 10 82060572 missense probably benign 0.33
R1892:Zfp873 UTSW 10 82061246 missense probably damaging 1.00
R2061:Zfp873 UTSW 10 82060157 missense probably benign 0.01
R3735:Zfp873 UTSW 10 82061181 missense probably benign 0.15
R4422:Zfp873 UTSW 10 82060874 missense probably benign 0.13
R4674:Zfp873 UTSW 10 82059980 missense possibly damaging 0.53
R4839:Zfp873 UTSW 10 82060519 missense probably damaging 0.98
R5154:Zfp873 UTSW 10 82060191 missense possibly damaging 0.54
R5160:Zfp873 UTSW 10 82061042 missense possibly damaging 0.54
R5811:Zfp873 UTSW 10 82060733 missense probably damaging 1.00
R6625:Zfp873 UTSW 10 82060304 missense probably damaging 1.00
R6667:Zfp873 UTSW 10 82060589 missense probably benign 0.22
R6742:Zfp873 UTSW 10 82058422 missense probably damaging 1.00
R6878:Zfp873 UTSW 10 82060695 missense probably benign 0.33
R7055:Zfp873 UTSW 10 82059998 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTCATACTGGAGAGAAACCGTAT -3'
(R):5'- CCCGTGTGAGTTCTTTTGTGTAC -3'

Sequencing Primer
(F):5'- AGAAACCGTATGAATGTAATCAGTG -3'
(R):5'- GTGTACCTGCAGATTACTGAGCC -3'
Posted On2016-06-21