Incidental Mutation 'R5147:Adgrf2'
ID395178
Institutional Source Beutler Lab
Gene Symbol Adgrf2
Ensembl Gene ENSMUSG00000057899
Gene Nameadhesion G protein-coupled receptor F2
SynonymsGpr111, PGR20
MMRRC Submission 042731-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5147 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location42708936-42742179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42710683 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 417 (Y417H)
Ref Sequence ENSEMBL: ENSMUSP00000109244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113614]
Predicted Effect probably damaging
Transcript: ENSMUST00000113614
AA Change: Y417H

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109244
Gene: ENSMUSG00000057899
AA Change: Y417H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
GPS 325 376 2.05e-4 SMART
Pfam:7tm_2 378 625 4.1e-29 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter allele exhibit normal viability and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,015,315 Y2121H probably benign Het
Ap5z1 A C 5: 142,466,510 D66A probably benign Het
Cachd1 T A 4: 100,964,491 Y422N probably damaging Het
Ccdc151 T C 9: 21,994,862 E260G probably benign Het
Cfap54 C T 10: 92,937,838 G114D probably benign Het
Cgref1 C T 5: 30,933,705 G255E probably benign Het
Cyp2a22 A C 7: 26,936,325 L271R probably damaging Het
Dcp2 G T 18: 44,417,595 E379* probably null Het
Fhl3 T A 4: 124,707,931 D277E probably benign Het
Gm19684 C T 17: 36,128,519 V190M probably damaging Het
Hpse T C 5: 100,719,509 D29G probably benign Het
Il31 T C 5: 123,482,058 probably benign Het
Ilk T C 7: 105,742,567 C422R possibly damaging Het
Itga1 T G 13: 114,985,142 D777A possibly damaging Het
Kank3 A G 17: 33,822,202 D556G probably damaging Het
Lrit3 A G 3: 129,803,925 S36P possibly damaging Het
Magi1 C T 6: 93,747,267 E256K probably damaging Het
Mroh9 C G 1: 163,060,760 G249R probably damaging Het
Mymk C T 2: 27,062,287 M148I probably benign Het
Nlrp12 T A 7: 3,241,373 I170F possibly damaging Het
Olfr1043 A T 2: 86,162,034 I305K possibly damaging Het
Olfr235 T A 19: 12,268,904 S225T probably damaging Het
Pkd1l1 G A 11: 8,849,003 T1803I possibly damaging Het
Ppp2r2b C T 18: 42,645,877 V398I probably benign Het
Ppp2r5e T A 12: 75,469,770 R214S probably damaging Het
Prss16 T C 13: 22,006,094 D298G possibly damaging Het
Qprt G A 7: 127,108,450 R189W probably damaging Het
Rara C T 11: 98,950,724 S36F probably benign Het
Rasal2 A G 1: 157,175,694 V465A probably damaging Het
Slc22a1 C T 17: 12,650,951 G508R probably damaging Het
Slco2a1 C A 9: 103,050,269 F120L probably damaging Het
Tex15 T A 8: 33,572,312 L864* probably null Het
Tssk4 A G 14: 55,650,973 I100V possibly damaging Het
Vgll4 A G 6: 114,890,615 probably null Het
Vmn1r65 T G 7: 6,008,819 I139L probably benign Het
Vps13b C T 15: 35,456,678 P757S probably benign Het
Ythdc2 G A 18: 44,844,292 G385E probably damaging Het
Other mutations in Adgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Adgrf2 APN 17 42714315 splice site probably benign
IGL01089:Adgrf2 APN 17 42710158 missense probably damaging 1.00
IGL01601:Adgrf2 APN 17 42710049 missense probably benign
IGL01765:Adgrf2 APN 17 42719535 missense probably benign 0.06
IGL02946:Adgrf2 APN 17 42710493 missense probably damaging 1.00
R0498:Adgrf2 UTSW 17 42714315 splice site probably benign
R0720:Adgrf2 UTSW 17 42713172 missense probably damaging 1.00
R0831:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R1664:Adgrf2 UTSW 17 42714414 missense possibly damaging 0.92
R2008:Adgrf2 UTSW 17 42710122 missense probably damaging 0.96
R2306:Adgrf2 UTSW 17 42713119 missense possibly damaging 0.92
R2519:Adgrf2 UTSW 17 42710407 missense probably damaging 1.00
R3713:Adgrf2 UTSW 17 42713088 missense probably damaging 1.00
R3736:Adgrf2 UTSW 17 42711012 missense probably benign 0.32
R4272:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4273:Adgrf2 UTSW 17 42710122 missense probably damaging 0.99
R4422:Adgrf2 UTSW 17 42713155 missense probably benign
R4732:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4733:Adgrf2 UTSW 17 42710754 missense probably damaging 1.00
R4906:Adgrf2 UTSW 17 42711193 missense probably benign
R5053:Adgrf2 UTSW 17 42710443 missense probably damaging 0.96
R5078:Adgrf2 UTSW 17 42710986 missense probably damaging 1.00
R5089:Adgrf2 UTSW 17 42710097 missense probably benign 0.00
R5953:Adgrf2 UTSW 17 42710338 missense probably damaging 1.00
R5968:Adgrf2 UTSW 17 42715172 critical splice donor site probably null
R6791:Adgrf2 UTSW 17 42710883 missense probably benign 0.02
R7138:Adgrf2 UTSW 17 42710983 missense probably damaging 1.00
X0061:Adgrf2 UTSW 17 42713074 missense probably benign 0.37
X0067:Adgrf2 UTSW 17 42710668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTTGGGCAGTGTATGAAAC -3'
(R):5'- CAAGCTGTTTGCCGTTGTC -3'

Sequencing Primer
(F):5'- AGGAGAGCCTTGGCAAGCATC -3'
(R):5'- CGTTGTCGGCCGAATAAGTTATATAC -3'
Posted On2016-06-21