Incidental Mutation 'R5148:Olfr1162'
ID395186
Institutional Source Beutler Lab
Gene Symbol Olfr1162
Ensembl Gene ENSMUSG00000075139
Gene Nameolfactory receptor 1162
SynonymsMOR174-14, GA_x6K02T2Q125-49542541-49541597
MMRRC Submission 043262-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88045920-88051129 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88050393 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 77 (T77I)
Ref Sequence ENSEMBL: ENSMUSP00000139068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099837] [ENSMUST00000183862]
Predicted Effect probably benign
Transcript: ENSMUST00000099837
AA Change: T77I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097425
Gene: ENSMUSG00000075139
AA Change: T77I

DomainStartEndE-ValueType
Pfam:7tm_4 33 310 2.9e-46 PFAM
Pfam:7tm_1 43 292 1.5e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183862
AA Change: T77I

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000139068
Gene: ENSMUSG00000075139
AA Change: T77I

DomainStartEndE-ValueType
Pfam:7tm_1 43 292 4.2e-27 PFAM
Pfam:7tm_4 141 285 3.1e-37 PFAM
Meta Mutation Damage Score 0.1068 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 probably benign Het
Egfem1 G A 3: 29,457,823 probably benign Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 noncoding transcript Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Map3k14 T C 11: 103,239,332 H253R probably benign Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V855A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L96Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K189R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Olfr1162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Olfr1162 APN 2 88049784 missense possibly damaging 0.63
IGL01965:Olfr1162 APN 2 88050436 missense probably benign 0.14
IGL02183:Olfr1162 APN 2 88049989 missense possibly damaging 0.96
R0281:Olfr1162 UTSW 2 88050412 missense possibly damaging 0.96
R0501:Olfr1162 UTSW 2 88050471 missense probably damaging 1.00
R4254:Olfr1162 UTSW 2 88049779 missense possibly damaging 0.62
R4589:Olfr1162 UTSW 2 88050479 missense probably benign 0.12
R4824:Olfr1162 UTSW 2 88050088 missense probably damaging 1.00
R5580:Olfr1162 UTSW 2 88050324 missense possibly damaging 0.79
R6174:Olfr1162 UTSW 2 88050302 nonsense probably null
R6888:Olfr1162 UTSW 2 88050264 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATATGACCCAGTCACAAGCAGG -3'
(R):5'- TTGGGCTTCACAGACTACCCTG -3'

Sequencing Primer
(F):5'- CTTGGTGACATGGCCACAGTATAC -3'
(R):5'- TTCACAGACTACCCTGAGCTTCAG -3'
Posted On2016-06-21