Incidental Mutation 'R5148:Map3k14'
ID395210
Institutional Source Beutler Lab
Gene Symbol Map3k14
Ensembl Gene ENSMUSG00000020941
Gene Namemitogen-activated protein kinase kinase kinase 14
SynonymsNik
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.497) question?
Stock #R5148 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location103219762-103267472 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103239332 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 253 (H253R)
Ref Sequence ENSEMBL: ENSMUSP00000021324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021324]
PDB Structure
Crystal structure of apo murine Nf-kappaB inducing kinase (NIK) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 6-alkynylindoline (cmp1) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) bound to a 2-(aminothiazoly)phenol (cmp2) [X-RAY DIFFRACTION]
Crystal structure of murine NF-kappaB inducing kinase (NIK) V408L bound to a 2-(aminothiazolyl)phenol (cmp3) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000021324
AA Change: H253R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000021324
Gene: ENSMUSG00000020941
AA Change: H253R

DomainStartEndE-ValueType
low complexity region 134 153 N/A INTRINSIC
Pfam:Pkinase 402 653 2.1e-42 PFAM
Pfam:Pkinase_Tyr 402 653 1.5e-24 PFAM
low complexity region 706 719 N/A INTRINSIC
low complexity region 760 774 N/A INTRINSIC
low complexity region 789 804 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152300
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152677
Meta Mutation Damage Score 0.1296 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype Homozygotes for a spontaneous mutation exhibit deficiencies in cellular and humoral immunity, susceptibility to infections, absence of lymph nodes and Peyer's patches, failure of isotype switching, and inflammation of exocrine organs.
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 127,025,636 probably null Het
Atf7 A G 15: 102,547,173 M252T probably benign Het
Cacna1h C A 17: 25,387,545 D1027Y probably damaging Het
Cngb1 A G 8: 95,265,983 V667A probably benign Het
Cntf T C 19: 12,764,004 E164G probably damaging Het
Dbt T C 3: 116,528,244 noncoding transcript Het
Egfem1 G A 3: 29,457,823 noncoding transcript Het
Gm12790 C T 4: 101,968,071 V49I possibly damaging Het
Gm5444 C T 13: 4,834,315 L97F unknown Het
Gpcpd1 A T 2: 132,534,190 Y574* probably null Het
Gss G T 2: 155,573,109 N225K possibly damaging Het
Il17rc G T 6: 113,482,997 A635S probably benign Het
Lhfpl5 T A 17: 28,579,968 D150E probably damaging Het
Lin9 T A 1: 180,669,198 L351I probably benign Het
Lrrc40 T G 3: 158,054,569 probably null Het
Ly6f A G 15: 75,271,797 T118A probably benign Het
Malrd1 A G 2: 16,142,226 N1960D unknown Het
Morc2a T C 11: 3,689,084 L1025P probably damaging Het
Nlrc5 G T 8: 94,476,693 G474W probably damaging Het
Olfr1162 G A 2: 88,050,393 T77I probably benign Het
Olfr1487 C A 19: 13,619,510 S116* probably null Het
Olfr894 T C 9: 38,219,021 I66T probably benign Het
Olr1 G T 6: 129,493,609 D198E probably benign Het
Pafah1b1 A T 11: 74,684,452 S209T probably damaging Het
Phf14 A T 6: 11,961,642 Y426F possibly damaging Het
Phldb1 A G 9: 44,704,158 V108A probably benign Het
Pira2 T G 7: 3,844,593 R32S possibly damaging Het
Pnldc1 T C 17: 12,892,789 I344V probably benign Het
Prss29 T C 17: 25,320,907 V93A probably benign Het
Ptpn13 C T 5: 103,492,232 L186F probably damaging Het
Ralgps1 A C 2: 33,158,987 C303W probably damaging Het
Sdr42e1 T A 8: 117,663,603 N100Y probably damaging Het
Serpina11 A T 12: 103,986,244 L89Q probably damaging Het
Slc12a8 G A 16: 33,624,918 R448H probably benign Het
Snrpd1 T A 18: 10,626,892 V53E probably benign Het
Ssbp1 T C 6: 40,477,949 V114A possibly damaging Het
T A G 17: 8,436,205 E47G probably damaging Het
Tmem156 T C 5: 65,073,768 K253R probably benign Het
Trim47 G T 11: 116,107,852 Q314K possibly damaging Het
Vmn2r3 G T 3: 64,278,826 P146Q probably damaging Het
Vmn2r6 A C 3: 64,556,594 V273G probably damaging Het
Wrnip1 G T 13: 32,806,856 R366L probably damaging Het
Zfp981 A T 4: 146,536,900 H94L possibly damaging Het
Other mutations in Map3k14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Map3k14 APN 11 103227579 missense probably damaging 1.00
IGL00590:Map3k14 APN 11 103237554 missense probably damaging 1.00
IGL03065:Map3k14 APN 11 103225101 missense probably damaging 1.00
lucky UTSW 11 103249558 nonsense
R0020:Map3k14 UTSW 11 103227674 missense probably damaging 0.99
R0070:Map3k14 UTSW 11 103239554 critical splice acceptor site probably null
R0294:Map3k14 UTSW 11 103227137 missense possibly damaging 0.80
R0624:Map3k14 UTSW 11 103242291 missense possibly damaging 0.77
R0734:Map3k14 UTSW 11 103227000 missense probably benign 0.00
R1015:Map3k14 UTSW 11 103225300 missense probably damaging 1.00
R1170:Map3k14 UTSW 11 103238917 splice site noncoding transcript
R1487:Map3k14 UTSW 11 103225337 missense possibly damaging 0.48
R2204:Map3k14 UTSW 11 103239454 missense possibly damaging 0.82
R2880:Map3k14 UTSW 11 103221032 missense probably damaging 1.00
R4429:Map3k14 UTSW 11 103227584 missense probably damaging 1.00
R4624:Map3k14 UTSW 11 103231101 missense probably damaging 1.00
R4967:Map3k14 UTSW 11 103239531 missense probably benign 0.00
R5098:Map3k14 UTSW 11 103224359 missense probably damaging 1.00
R5208:Map3k14 UTSW 11 103239146 missense probably damaging 0.98
R5480:Map3k14 UTSW 11 103239504 missense probably benign 0.03
T0970:Map3k14 UTSW 11 103224298 nonsense probably null
X0023:Map3k14 UTSW 11 103239822 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCTGACTGTCTCCATGG -3'
(R):5'- GATGAGTCTCCACTAGGCAAC -3'

Sequencing Primer
(F):5'- ACTGTCTCCATGGGCCAGTTG -3'
(R):5'- GAGTCTCCACTAGGCAACCTCTATG -3'
Posted OnJun 21, 2016