Incidental Mutation 'R5148:Wrnip1'
ID 395214
Institutional Source Beutler Lab
Gene Symbol Wrnip1
Ensembl Gene ENSMUSG00000021400
Gene Name Werner helicase interacting protein 1
Synonyms 4833444L21Rik, WHIP
MMRRC Submission 043262-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5148 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 32986021-33006592 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32990839 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 366 (R366L)
Ref Sequence ENSEMBL: ENSMUSP00000021832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021832] [ENSMUST00000057911]
AlphaFold Q91XU0
Predicted Effect probably damaging
Transcript: ENSMUST00000021832
AA Change: R366L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021832
Gene: ENSMUSG00000021400
AA Change: R366L

DomainStartEndE-ValueType
ZnF_Rad18 17 40 4.76e-10 SMART
low complexity region 90 110 N/A INTRINSIC
low complexity region 135 156 N/A INTRINSIC
low complexity region 158 183 N/A INTRINSIC
AAA 255 375 9.86e-16 SMART
Pfam:AAA_assoc_2 413 506 6.4e-26 PFAM
Pfam:MgsA_C 507 659 3.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000057911
SMART Domains Protein: ENSMUSP00000050235
Gene: ENSMUSG00000042874

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
low complexity region 37 46 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
transmembrane domain 93 115 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221066
Predicted Effect probably benign
Transcript: ENSMUST00000229351
Meta Mutation Damage Score 0.9599 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Werner's syndrome is a rare autosomal recessive disorder characterized by accelerated aging that is caused by defects in the Werner syndrome ATP-dependent helicase gene (WRN). The protein encoded by this gene interacts with the exonuclease-containing N-terminal portion of the Werner protein. This protein has a ubiquitin-binding zinc-finger domain in the N-terminus, an ATPase domain, and two leucine zipper motifs in the C-terminus. It has sequence similarity to replication factor C family proteins and is conserved from E. coli to human. This protein likely accumulates at sites of DNA damage by interacting with polyubiquinated proteins and also binds to DNA polymerase delta and increases the initiation frequency of DNA polymerase delta-mediated DNA synthesis. This protein also interacts with nucleoporins at nuclear pore complexes. Two transcript variants encoding different isoforms have been isolated for this gene. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ank2 A T 3: 126,819,285 (GRCm39) probably null Het
Atf7 A G 15: 102,455,608 (GRCm39) M252T probably benign Het
Cacna1h C A 17: 25,606,519 (GRCm39) D1027Y probably damaging Het
Cngb1 A G 8: 95,992,611 (GRCm39) V667A probably benign Het
Cntf T C 19: 12,741,368 (GRCm39) E164G probably damaging Het
Dbt T C 3: 116,321,893 (GRCm39) probably benign Het
Egfem1 G A 3: 29,511,972 (GRCm39) probably benign Het
Gm12790 C T 4: 101,825,268 (GRCm39) V49I possibly damaging Het
Gm5444 C T 13: 4,884,314 (GRCm39) noncoding transcript Het
Gpcpd1 A T 2: 132,376,110 (GRCm39) Y574* probably null Het
Gss G T 2: 155,415,029 (GRCm39) N225K possibly damaging Het
Il17rc G T 6: 113,459,958 (GRCm39) A635S probably benign Het
Lhfpl5 T A 17: 28,798,942 (GRCm39) D150E probably damaging Het
Lin9 T A 1: 180,496,763 (GRCm39) L351I probably benign Het
Lrrc40 T G 3: 157,760,206 (GRCm39) probably null Het
Ly6f A G 15: 75,143,646 (GRCm39) T118A probably benign Het
Malrd1 A G 2: 16,147,037 (GRCm39) N1960D unknown Het
Map3k14 T C 11: 103,130,158 (GRCm39) H253R probably benign Het
Morc2a T C 11: 3,639,084 (GRCm39) L1025P probably damaging Het
Nlrc5 G T 8: 95,203,321 (GRCm39) G474W probably damaging Het
Olr1 G T 6: 129,470,572 (GRCm39) D198E probably benign Het
Or5b123 C A 19: 13,596,874 (GRCm39) S116* probably null Het
Or5d14 G A 2: 87,880,737 (GRCm39) T77I probably benign Het
Or8c16 T C 9: 38,130,317 (GRCm39) I66T probably benign Het
Pafah1b1 A T 11: 74,575,278 (GRCm39) S209T probably damaging Het
Phf14 A T 6: 11,961,641 (GRCm39) Y426F possibly damaging Het
Phldb1 A G 9: 44,615,455 (GRCm39) V855A probably benign Het
Pira2 T G 7: 3,847,592 (GRCm39) R32S possibly damaging Het
Pnldc1 T C 17: 13,111,676 (GRCm39) I344V probably benign Het
Prss29 T C 17: 25,539,881 (GRCm39) V93A probably benign Het
Ptpn13 C T 5: 103,640,098 (GRCm39) L186F probably damaging Het
Ralgps1 A C 2: 33,048,999 (GRCm39) C303W probably damaging Het
Sdr42e1 T A 8: 118,390,342 (GRCm39) N100Y probably damaging Het
Serpina11 A T 12: 103,952,503 (GRCm39) L96Q probably damaging Het
Slc12a8 G A 16: 33,445,288 (GRCm39) R448H probably benign Het
Snrpd1 T A 18: 10,626,892 (GRCm39) V53E probably benign Het
Ssbp1 T C 6: 40,454,883 (GRCm39) V114A possibly damaging Het
T A G 17: 8,655,037 (GRCm39) E47G probably damaging Het
Tmem156 T C 5: 65,231,111 (GRCm39) K189R probably benign Het
Trim47 G T 11: 115,998,678 (GRCm39) Q314K possibly damaging Het
Vmn2r3 G T 3: 64,186,247 (GRCm39) P146Q probably damaging Het
Vmn2r6 A C 3: 64,464,015 (GRCm39) V273G probably damaging Het
Zfp981 A T 4: 146,621,357 (GRCm39) H94L possibly damaging Het
Other mutations in Wrnip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Wrnip1 APN 13 33,000,312 (GRCm39) missense probably damaging 1.00
IGL02608:Wrnip1 APN 13 32,990,857 (GRCm39) missense probably damaging 1.00
IGL02947:Wrnip1 APN 13 33,006,053 (GRCm39) missense probably damaging 1.00
R0028:Wrnip1 UTSW 13 33,004,280 (GRCm39) missense probably damaging 1.00
R0131:Wrnip1 UTSW 13 32,990,847 (GRCm39) missense probably damaging 0.98
R0212:Wrnip1 UTSW 13 33,005,889 (GRCm39) missense probably benign 0.45
R0545:Wrnip1 UTSW 13 32,990,796 (GRCm39) missense probably damaging 1.00
R0638:Wrnip1 UTSW 13 33,005,073 (GRCm39) missense possibly damaging 0.82
R1650:Wrnip1 UTSW 13 32,989,362 (GRCm39) missense probably benign 0.02
R1894:Wrnip1 UTSW 13 32,989,319 (GRCm39) critical splice acceptor site probably null
R2176:Wrnip1 UTSW 13 33,004,223 (GRCm39) missense probably damaging 1.00
R2371:Wrnip1 UTSW 13 32,986,410 (GRCm39) missense probably benign
R2475:Wrnip1 UTSW 13 32,990,941 (GRCm39) missense probably benign 0.30
R3122:Wrnip1 UTSW 13 32,986,744 (GRCm39) missense probably benign 0.06
R4247:Wrnip1 UTSW 13 32,990,866 (GRCm39) missense probably damaging 1.00
R4604:Wrnip1 UTSW 13 32,986,330 (GRCm39) missense probably damaging 1.00
R4978:Wrnip1 UTSW 13 33,000,295 (GRCm39) missense probably damaging 1.00
R5109:Wrnip1 UTSW 13 33,000,319 (GRCm39) missense probably damaging 1.00
R5929:Wrnip1 UTSW 13 32,990,949 (GRCm39) missense probably damaging 1.00
R6750:Wrnip1 UTSW 13 32,986,739 (GRCm39) missense probably damaging 0.99
R7137:Wrnip1 UTSW 13 32,986,732 (GRCm39) missense probably benign 0.01
R7142:Wrnip1 UTSW 13 32,986,616 (GRCm39) missense possibly damaging 0.51
R7378:Wrnip1 UTSW 13 33,000,264 (GRCm39) missense probably benign 0.33
R7468:Wrnip1 UTSW 13 33,000,360 (GRCm39) missense possibly damaging 0.80
R7470:Wrnip1 UTSW 13 33,000,310 (GRCm39) nonsense probably null
R8049:Wrnip1 UTSW 13 33,005,960 (GRCm39) missense probably benign
R8260:Wrnip1 UTSW 13 32,989,339 (GRCm39) missense possibly damaging 0.80
R9000:Wrnip1 UTSW 13 32,986,711 (GRCm39) missense probably damaging 0.99
X0019:Wrnip1 UTSW 13 32,990,749 (GRCm39) missense probably damaging 1.00
X0027:Wrnip1 UTSW 13 32,986,707 (GRCm39) unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACAGAGACTCTTGAAATGGATGTG -3'
(R):5'- AGGGGCTGCACACAATCTAC -3'

Sequencing Primer
(F):5'- GACTCTTGAAATGGATGTGTCTAAAC -3'
(R):5'- CTCACTCAGAGCTGCAGTTG -3'
Posted On 2016-06-21