Incidental Mutation 'R0449:Hsf4'
ID39523
Institutional Source Beutler Lab
Gene Symbol Hsf4
Ensembl Gene ENSMUSG00000033249
Gene Nameheat shock transcription factor 4
Synonymsldis1
MMRRC Submission 038649-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0449 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105269801-105275845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105275590 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 411 (T411A)
Ref Sequence ENSEMBL: ENSMUSP00000126278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014920] [ENSMUST00000014981] [ENSMUST00000036127] [ENSMUST00000163734] [ENSMUST00000171788] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837] [ENSMUST00000212922]
Predicted Effect probably benign
Transcript: ENSMUST00000014920
SMART Domains Protein: ENSMUSP00000014920
Gene: ENSMUSG00000014776

DomainStartEndE-ValueType
CARD 4 92 2.1e-27 SMART
low complexity region 149 161 N/A INTRINSIC
low complexity region 173 209 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000014981
SMART Domains Protein: ENSMUSP00000014981
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
AA Change: T471A

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249
AA Change: T471A

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000163734
AA Change: T411A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249
AA Change: T411A

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000171788
SMART Domains Protein: ENSMUSP00000128530
Gene: ENSMUSG00000014837

DomainStartEndE-ValueType
DUF1704 148 457 1.07e-139 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
AA Change: T441A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249
AA Change: T441A

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
AA Change: T395A

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249
AA Change: T395A

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000212922
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Heat-shock transcription factors (HSFs) activate heat-shock response genes under conditions of heat or other stresses. HSF4 lacks the carboxyl-terminal hydrophobic repeat which is shared among all vertebrate HSFs and has been suggested to be involved in the negative regulation of DNA binding activity. Two alternatively spliced transcripts encoding distinct isoforms and possessing different transcriptional activity have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display abnormal lens morphology and cataracts. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb4 A T 5: 8,939,885 R813* probably null Het
Accsl T A 2: 93,866,074 I60F probably benign Het
Adam29 C T 8: 55,872,681 G246D probably benign Het
Ankrd13c A G 3: 157,991,714 I319V probably benign Het
B020004J07Rik T C 4: 101,836,961 S242G probably benign Het
Bag6 T G 17: 35,141,466 V327G probably damaging Het
Barhl1 C T 2: 28,915,292 A130T probably benign Het
Bend4 T C 5: 67,398,240 D541G probably damaging Het
Birc6 A C 17: 74,692,295 T4673P probably damaging Het
Ccdc81 T C 7: 89,890,471 R186G probably damaging Het
Cdyl2 A G 8: 116,583,192 F342L probably damaging Het
Chd3 C A 11: 69,357,541 V748L probably damaging Het
CN725425 G T 15: 91,238,944 R72I possibly damaging Het
Col22a1 A G 15: 71,962,671 probably null Het
Cops3 A G 11: 59,818,417 probably null Het
Ctnnd1 G T 2: 84,603,262 Q940K possibly damaging Het
Dtnb C T 12: 3,591,971 Q45* probably null Het
Efr3a T A 15: 65,842,704 I280K probably damaging Het
Eml6 A C 11: 29,893,213 V167G probably benign Het
Fam83c T A 2: 155,830,295 M407L probably benign Het
Fasn T C 11: 120,811,068 T1862A probably benign Het
Fbxl6 A G 15: 76,535,955 I486T probably damaging Het
Gpr182 A G 10: 127,750,696 Y129H probably damaging Het
Gpr75 A G 11: 30,892,456 S454G probably damaging Het
Hectd4 G A 5: 121,364,590 probably null Het
Hsh2d G A 8: 72,200,460 D229N probably benign Het
Il4 A T 11: 53,618,605 M1K probably null Het
Ints11 G T 4: 155,887,948 R463L probably benign Het
Ints4 G A 7: 97,529,223 E677K probably damaging Het
Klk1b11 G A 7: 43,997,792 C50Y probably damaging Het
Krt14 C A 11: 100,207,395 G21C unknown Het
Krt81 C A 15: 101,463,627 R24L possibly damaging Het
L3mbtl2 C T 15: 81,668,741 A125V probably damaging Het
Lama3 A G 18: 12,500,512 probably null Het
Lrrk2 T C 15: 91,750,275 L1414P probably damaging Het
Matn2 T C 15: 34,428,541 S684P probably damaging Het
Mga T A 2: 119,941,381 V1574D probably damaging Het
Mia2 T C 12: 59,172,594 probably null Het
Mrpl21 T A 19: 3,292,459 probably benign Het
Msh5 T A 17: 35,041,482 Q266L probably benign Het
Mybpc1 C A 10: 88,540,960 C758F probably damaging Het
Myo15 G A 11: 60,509,596 A2932T possibly damaging Het
Nbas T A 12: 13,519,108 I2021K probably benign Het
Neurl4 T C 11: 69,905,567 S424P probably damaging Het
Olfr16 T A 1: 172,957,398 V201E probably damaging Het
Olfr322 A C 11: 58,665,963 I135L probably benign Het
Olfr782 A G 10: 129,351,234 M224V probably benign Het
Olfr829 T C 9: 18,856,649 M8T probably benign Het
Olfr850 T A 9: 19,478,092 I53F possibly damaging Het
Phlpp1 C T 1: 106,350,578 R907W probably damaging Het
Pigg T C 5: 108,336,411 V508A probably benign Het
Pkhd1l1 T G 15: 44,501,519 Y685D probably damaging Het
Polr3a A T 14: 24,484,466 I34N probably damaging Het
Prex1 A G 2: 166,569,377 V1434A probably benign Het
Ptprh T A 7: 4,598,006 D124V probably damaging Het
Rad54b T A 4: 11,606,131 I513N probably benign Het
Rbm12b1 A G 4: 12,145,507 N493S probably benign Het
Rfx7 A T 9: 72,610,304 probably null Het
Serpini1 A G 3: 75,613,341 K82E probably benign Het
Slc27a6 T G 18: 58,609,165 probably null Het
Slc35f2 G T 9: 53,816,917 L358F probably damaging Het
Slc45a1 A C 4: 150,643,305 I158M probably damaging Het
Slurp2 G A 15: 74,743,106 P62L probably damaging Het
Sspo C T 6: 48,466,740 H1949Y probably damaging Het
Tiam1 A T 16: 89,837,827 V865E possibly damaging Het
Tlr4 A C 4: 66,839,620 I217L probably damaging Het
Top1 C T 2: 160,712,708 R460* probably null Het
Trpm3 T A 19: 22,988,054 S1638T probably benign Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Vars T G 17: 35,012,727 probably null Het
Xylt2 A G 11: 94,666,333 Y111H probably benign Het
Zbed5 G A 5: 129,901,726 G172D probably damaging Het
Zfp53 C T 17: 21,508,833 T376I probably benign Het
Zfp937 G T 2: 150,239,546 V499L probably benign Het
Zyx T A 6: 42,351,313 L152Q probably damaging Het
Other mutations in Hsf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01294:Hsf4 APN 8 105275657 makesense probably null
IGL01702:Hsf4 APN 8 105271589 missense probably damaging 1.00
IGL02040:Hsf4 APN 8 105275667 unclassified probably benign
R0115:Hsf4 UTSW 8 105272704 critical splice acceptor site probably null
R0585:Hsf4 UTSW 8 105271031 missense probably damaging 1.00
R1365:Hsf4 UTSW 8 105271094 missense probably damaging 0.99
R1401:Hsf4 UTSW 8 105275603 missense probably benign
R2276:Hsf4 UTSW 8 105269996 missense probably null 0.91
R2278:Hsf4 UTSW 8 105269996 missense probably null 0.91
R3848:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R3850:Hsf4 UTSW 8 105270837 missense probably damaging 1.00
R4240:Hsf4 UTSW 8 105274881 missense possibly damaging 0.58
R4781:Hsf4 UTSW 8 105274752 critical splice donor site probably null
R4790:Hsf4 UTSW 8 105270605 missense probably damaging 1.00
R4917:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4918:Hsf4 UTSW 8 105272735 missense probably benign 0.00
R4930:Hsf4 UTSW 8 105272698 splice site probably null
R5110:Hsf4 UTSW 8 105272795 missense probably benign 0.01
R5189:Hsf4 UTSW 8 105271428 frame shift probably null
R6001:Hsf4 UTSW 8 105272909 missense possibly damaging 0.70
R6167:Hsf4 UTSW 8 105270849 missense probably damaging 1.00
R6802:Hsf4 UTSW 8 105274668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGTGATGCTACACCCTAACTGAAG -3'
(R):5'- TAGGCACTGGCTCTCCAAGTACACTG -3'

Sequencing Primer
(F):5'- ACCCTAACTGAAGGGGGC -3'
(R):5'- TCTTCCATGAAAGTCCGAGCG -3'
Posted On2013-05-23