Incidental Mutation 'R5150:Ccdc73'
ID395286
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Namecoiled-coil domain containing 73
Synonyms2210415I11Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R5150 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104867805-105017904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104992039 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 778 (T778A)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
Predicted Effect probably benign
Transcript: ENSMUST00000111114
AA Change: T778A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: T778A

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Meta Mutation Damage Score 0.1592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,193,270 S228P possibly damaging Het
9930021J03Rik C A 19: 29,805,550 A109S probably damaging Het
Adam33 T C 2: 131,053,197 probably benign Het
Ahnak T C 19: 9,010,904 V3184A possibly damaging Het
Aoc1 A G 6: 48,906,150 N320S possibly damaging Het
Bin2 T C 15: 100,645,363 E313G probably damaging Het
Ccdc47 T C 11: 106,205,439 D253G possibly damaging Het
Cops3 C A 11: 59,820,013 D377Y probably damaging Het
Cyp4a14 A C 4: 115,493,609 V156G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disp1 C A 1: 183,089,499 M452I probably damaging Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Fbxo45 C A 16: 32,246,706 probably benign Het
Flrt2 T A 12: 95,779,203 M105K possibly damaging Het
Gm26558 G A 2: 70,661,312 probably benign Het
Gpr83 T G 9: 14,860,805 L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 probably null Het
Hmces T A 6: 87,933,235 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ksr2 A C 5: 117,555,009 E174A probably damaging Het
Lats1 A G 10: 7,712,651 T1011A probably benign Het
Lrrc46 T C 11: 97,036,131 D120G probably damaging Het
Ncstn C A 1: 172,067,584 probably benign Het
Neb T C 2: 52,169,118 T6118A probably benign Het
Nipsnap2 A C 5: 129,757,111 M272L probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1284 T A 2: 111,379,253 D84E probably damaging Het
Olfr1309 T A 2: 111,984,021 T18S probably benign Het
Olfr1314 T A 2: 112,092,535 L55F possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr1474 A T 19: 13,471,430 Q153H probably benign Het
Olfr157 A G 4: 43,836,301 L63P probably damaging Het
Pold1 A G 7: 44,535,832 V750A possibly damaging Het
Prdm11 C T 2: 92,975,472 E378K probably damaging Het
Ptpn9 A G 9: 57,036,670 D276G probably benign Het
Rlf A T 4: 121,148,172 F1204I probably damaging Het
Robo1 C A 16: 72,972,304 T537K possibly damaging Het
Sec31b T A 19: 44,520,531 M670L probably benign Het
Sephs1 T A 2: 4,899,510 V233E possibly damaging Het
Serpinb2 T C 1: 107,523,209 probably null Het
Sf3b3 T C 8: 110,823,376 Q670R possibly damaging Het
Slc8a2 A C 7: 16,145,176 D529A possibly damaging Het
Sva A G 6: 42,042,159 N88D probably benign Het
Tcf15 G T 2: 152,144,131 R169L probably damaging Het
Tfr2 A G 5: 137,574,490 T188A probably benign Het
Tshz1 T A 18: 84,013,215 K1023* probably null Het
Ttc28 A G 5: 111,225,689 N966S probably damaging Het
Unc5c T A 3: 141,757,793 I225N probably damaging Het
Ush2a T C 1: 188,451,870 L1457S possibly damaging Het
Zbtb34 G T 2: 33,411,121 H469Q probably damaging Het
Zfp692 T C 11: 58,307,587 M1T probably null Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104994591 missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104907627 missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104975616 missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104907568 missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104991840 unclassified probably benign
FR4737:Ccdc73 UTSW 2 104991840 unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104951936 missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104980987 splice site probably benign
R0040:Ccdc73 UTSW 2 104992084 missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104929570 splice site probably benign
R0360:Ccdc73 UTSW 2 104981007 missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104991289 missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104973154 splice site probably benign
R0839:Ccdc73 UTSW 2 104991097 missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104992190 missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104991561 missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104907610 missense possibly damaging 0.72
R1478:Ccdc73 UTSW 2 104914667 missense possibly damaging 0.93
R1695:Ccdc73 UTSW 2 104992105 missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104992292 missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104926935 missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104931045 nonsense probably null
R1987:Ccdc73 UTSW 2 104999159 missense probably damaging 1.00
R2938:Ccdc73 UTSW 2 104975635 nonsense probably null
R3420:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3420:Ccdc73 UTSW 2 104951948 splice site probably null
R3422:Ccdc73 UTSW 2 104951947 missense probably null 1.00
R3422:Ccdc73 UTSW 2 104951948 splice site probably null
R3522:Ccdc73 UTSW 2 104991485 missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104991343 missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104985010 missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104981105 splice site probably null
R4793:Ccdc73 UTSW 2 105017782 utr 3 prime probably null
R4939:Ccdc73 UTSW 2 104992157 unclassified probably null
R4950:Ccdc73 UTSW 2 104992366 missense probably benign
R5093:Ccdc73 UTSW 2 105017766 utr 3 prime probably benign
R5381:Ccdc73 UTSW 2 104989925 missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104930986 missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104992137 missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104907633 missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104992088 missense probably benign 0.00
R6753:Ccdc73 UTSW 2 104991524 nonsense probably null
R7062:Ccdc73 UTSW 2 104951878 missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104973224 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- AACCATTGCCTGTGCTGCAG -3'
(R):5'- AGGATGCCGTTTAATGCCTCTG -3'

Sequencing Primer
(F):5'- AGTCGTCAGCCCACTTGGTC -3'
(R):5'- ATGCCGTTTAATGCCTCTGTTTTG -3'
Posted On2016-06-21