Incidental Mutation 'R5150:Olfr1284'
ID395287
Institutional Source Beutler Lab
Gene Symbol Olfr1284
Ensembl Gene ENSMUSG00000108931
Gene Nameolfactory receptor 1284
SynonymsMOR245-13, GA_x6K02T2Q125-72430580-72431515
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5150 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location111375522-111380613 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 111379253 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000147014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062407] [ENSMUST00000209096]
Predicted Effect probably damaging
Transcript: ENSMUST00000062407
AA Change: D84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052153
Gene: ENSMUSG00000108931
AA Change: D84E

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 7.2e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 302 2.4e-5 PFAM
Pfam:7tm_1 41 287 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209096
AA Change: D84E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0252 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,193,270 S228P possibly damaging Het
9930021J03Rik C A 19: 29,805,550 A109S probably damaging Het
Adam33 T C 2: 131,053,197 probably benign Het
Ahnak T C 19: 9,010,904 V3184A possibly damaging Het
Aoc1 A G 6: 48,906,150 N320S possibly damaging Het
Bin2 T C 15: 100,645,363 E313G probably damaging Het
Ccdc47 T C 11: 106,205,439 D253G possibly damaging Het
Ccdc73 A G 2: 104,992,039 T778A probably benign Het
Cops3 C A 11: 59,820,013 D377Y probably damaging Het
Cyp4a14 A C 4: 115,493,609 V156G probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disp1 C A 1: 183,089,499 M452I probably damaging Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Fbxo45 C A 16: 32,246,706 probably benign Het
Flrt2 T A 12: 95,779,203 M105K possibly damaging Het
Gm26558 G A 2: 70,661,312 probably benign Het
Gpr83 T G 9: 14,860,805 L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 probably null Het
Hmces T A 6: 87,933,235 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ksr2 A C 5: 117,555,009 E174A probably damaging Het
Lats1 A G 10: 7,712,651 T1011A probably benign Het
Lrrc46 T C 11: 97,036,131 D120G probably damaging Het
Ncstn C A 1: 172,067,584 probably benign Het
Neb T C 2: 52,169,118 T6118A probably benign Het
Nipsnap2 A C 5: 129,757,111 M272L probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1309 T A 2: 111,984,021 T18S probably benign Het
Olfr1314 T A 2: 112,092,535 L55F possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr1474 A T 19: 13,471,430 Q153H probably benign Het
Olfr157 A G 4: 43,836,301 L63P probably damaging Het
Pold1 A G 7: 44,535,832 V750A possibly damaging Het
Prdm11 C T 2: 92,975,472 E378K probably damaging Het
Ptpn9 A G 9: 57,036,670 D276G probably benign Het
Rlf A T 4: 121,148,172 F1204I probably damaging Het
Robo1 C A 16: 72,972,304 T537K possibly damaging Het
Sec31b T A 19: 44,520,531 M670L probably benign Het
Sephs1 T A 2: 4,899,510 V233E possibly damaging Het
Serpinb2 T C 1: 107,523,209 probably null Het
Sf3b3 T C 8: 110,823,376 Q670R possibly damaging Het
Slc8a2 A C 7: 16,145,176 D529A possibly damaging Het
Sva A G 6: 42,042,159 N88D probably benign Het
Tcf15 G T 2: 152,144,131 R169L probably damaging Het
Tfr2 A G 5: 137,574,490 T188A probably benign Het
Tshz1 T A 18: 84,013,215 K1023* probably null Het
Ttc28 A G 5: 111,225,689 N966S probably damaging Het
Unc5c T A 3: 141,757,793 I225N probably damaging Het
Ush2a T C 1: 188,451,870 L1457S possibly damaging Het
Zbtb34 G T 2: 33,411,121 H469Q probably damaging Het
Zfp692 T C 11: 58,307,587 M1T probably null Het
Other mutations in Olfr1284
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03024:Olfr1284 APN 2 111379590 missense possibly damaging 0.94
R0526:Olfr1284 UTSW 2 111379492 missense possibly damaging 0.95
R0731:Olfr1284 UTSW 2 111379293 missense probably damaging 0.99
R1762:Olfr1284 UTSW 2 111379573 missense probably damaging 0.99
R1765:Olfr1284 UTSW 2 111379146 missense probably benign 0.39
R3106:Olfr1284 UTSW 2 111379495 missense probably benign 0.23
R3803:Olfr1284 UTSW 2 111379293 missense possibly damaging 0.95
R3894:Olfr1284 UTSW 2 111379637 missense probably benign 0.09
R4005:Olfr1284 UTSW 2 111379743 missense probably benign 0.05
R4227:Olfr1284 UTSW 2 111379065 missense probably benign
R4637:Olfr1284 UTSW 2 111379582 missense probably benign 0.03
R4707:Olfr1284 UTSW 2 111379645 missense probably damaging 1.00
R4762:Olfr1284 UTSW 2 111379737 missense probably damaging 1.00
R5309:Olfr1284 UTSW 2 111379834 missense possibly damaging 0.52
R5312:Olfr1284 UTSW 2 111379834 missense possibly damaging 0.52
R6554:Olfr1284 UTSW 2 111379159 missense possibly damaging 0.95
R6913:Olfr1284 UTSW 2 111379002 start codon destroyed probably null 0.03
R6980:Olfr1284 UTSW 2 111379275 missense possibly damaging 0.77
R6995:Olfr1284 UTSW 2 111379363 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGTTGGGACTCTCCAGTTC -3'
(R):5'- TGACATGGCATGGACCACTC -3'

Sequencing Primer
(F):5'- AAAATACAATTTTTCTCATGTCCACC -3'
(R):5'- CAAATGAAATGCATATTCTAGGGCTC -3'
Posted On2016-06-21