Incidental Mutation 'R5150:Cyp4a14'
ID395295
Institutional Source Beutler Lab
Gene Symbol Cyp4a14
Ensembl Gene ENSMUSG00000028715
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R5150 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location115486200-115496142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115493609 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 156 (V156G)
Ref Sequence ENSEMBL: ENSMUSP00000030487 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030487]
Predicted Effect probably damaging
Transcript: ENSMUST00000030487
AA Change: V156G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000030487
Gene: ENSMUSG00000028715
AA Change: V156G

DomainStartEndE-ValueType
transmembrane domain 15 32 N/A INTRINSIC
Pfam:p450 51 503 5.4e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124412
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency 93% (57/61)
MGI Phenotype PHENOTYPE: Male mice homozygous for disruption of this gene display high blood pressure. Blood pressure is elevated in females as well to levels comparable to normotensive males. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik A G 4: 35,193,270 S228P possibly damaging Het
9930021J03Rik C A 19: 29,805,550 A109S probably damaging Het
Adam33 T C 2: 131,053,197 probably benign Het
Ahnak T C 19: 9,010,904 V3184A possibly damaging Het
Aoc1 A G 6: 48,906,150 N320S possibly damaging Het
Bin2 T C 15: 100,645,363 E313G probably damaging Het
Ccdc47 T C 11: 106,205,439 D253G possibly damaging Het
Ccdc73 A G 2: 104,992,039 T778A probably benign Het
Cops3 C A 11: 59,820,013 D377Y probably damaging Het
D6Ertd527e C G 6: 87,111,524 T223S unknown Het
Disp1 C A 1: 183,089,499 M452I probably damaging Het
Fam210b T C 2: 172,351,548 Y94H probably damaging Het
Fbxo45 C A 16: 32,246,706 probably benign Het
Flrt2 T A 12: 95,779,203 M105K possibly damaging Het
Gm26558 G A 2: 70,661,312 probably benign Het
Gpr83 T G 9: 14,860,805 L91R probably damaging Het
Greb1l TTTAATAACTT TTT 18: 10,555,950 probably null Het
Hmces T A 6: 87,933,235 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Ksr2 A C 5: 117,555,009 E174A probably damaging Het
Lats1 A G 10: 7,712,651 T1011A probably benign Het
Lrrc46 T C 11: 97,036,131 D120G probably damaging Het
Ncstn C A 1: 172,067,584 probably benign Het
Neb T C 2: 52,169,118 T6118A probably benign Het
Nipsnap2 A C 5: 129,757,111 M272L probably benign Het
Nlgn2 C T 11: 69,825,390 R775H probably damaging Het
Olfr1284 T A 2: 111,379,253 D84E probably damaging Het
Olfr1309 T A 2: 111,984,021 T18S probably benign Het
Olfr1314 T A 2: 112,092,535 L55F possibly damaging Het
Olfr135 A C 17: 38,208,317 E24A possibly damaging Het
Olfr1474 A T 19: 13,471,430 Q153H probably benign Het
Olfr157 A G 4: 43,836,301 L63P probably damaging Het
Pold1 A G 7: 44,535,832 V750A possibly damaging Het
Prdm11 C T 2: 92,975,472 E378K probably damaging Het
Ptpn9 A G 9: 57,036,670 D276G probably benign Het
Rlf A T 4: 121,148,172 F1204I probably damaging Het
Robo1 C A 16: 72,972,304 T537K possibly damaging Het
Sec31b T A 19: 44,520,531 M670L probably benign Het
Sephs1 T A 2: 4,899,510 V233E possibly damaging Het
Serpinb2 T C 1: 107,523,209 probably null Het
Sf3b3 T C 8: 110,823,376 Q670R possibly damaging Het
Slc8a2 A C 7: 16,145,176 D529A possibly damaging Het
Sva A G 6: 42,042,159 N88D probably benign Het
Tcf15 G T 2: 152,144,131 R169L probably damaging Het
Tfr2 A G 5: 137,574,490 T188A probably benign Het
Tshz1 T A 18: 84,013,215 K1023* probably null Het
Ttc28 A G 5: 111,225,689 N966S probably damaging Het
Unc5c T A 3: 141,757,793 I225N probably damaging Het
Ush2a T C 1: 188,451,870 L1457S possibly damaging Het
Zbtb34 G T 2: 33,411,121 H469Q probably damaging Het
Zfp692 T C 11: 58,307,587 M1T probably null Het
Other mutations in Cyp4a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Cyp4a14 APN 4 115489952 splice site probably benign
IGL01539:Cyp4a14 APN 4 115487177 missense possibly damaging 0.71
IGL01802:Cyp4a14 APN 4 115494937 nonsense probably null
IGL02309:Cyp4a14 APN 4 115491632 missense probably damaging 0.99
IGL02330:Cyp4a14 APN 4 115495027 splice site probably benign
IGL03302:Cyp4a14 APN 4 115491378 missense probably benign 0.00
R1037:Cyp4a14 UTSW 4 115489996 missense probably damaging 1.00
R1236:Cyp4a14 UTSW 4 115492170 missense probably benign 0.01
R2132:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2133:Cyp4a14 UTSW 4 115491391 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2870:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2871:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2872:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R2873:Cyp4a14 UTSW 4 115487301 missense probably damaging 1.00
R4015:Cyp4a14 UTSW 4 115491134 missense probably damaging 1.00
R4925:Cyp4a14 UTSW 4 115495936 missense possibly damaging 0.68
R5104:Cyp4a14 UTSW 4 115495929 missense probably damaging 1.00
R5135:Cyp4a14 UTSW 4 115489960 critical splice donor site probably null
R5930:Cyp4a14 UTSW 4 115491410 missense probably damaging 1.00
R5997:Cyp4a14 UTSW 4 115496100 nonsense probably null
R6269:Cyp4a14 UTSW 4 115491131 missense possibly damaging 0.87
R6354:Cyp4a14 UTSW 4 115487244 missense probably damaging 1.00
R6377:Cyp4a14 UTSW 4 115496083 missense probably benign 0.01
R6534:Cyp4a14 UTSW 4 115489959 splice site probably null
R6563:Cyp4a14 UTSW 4 115492086 missense probably benign 0.23
R6751:Cyp4a14 UTSW 4 115491194 missense probably damaging 0.99
R7039:Cyp4a14 UTSW 4 115491081 missense probably benign 0.23
R7125:Cyp4a14 UTSW 4 115491161 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGTGCTATCTGAAGTCTGTG -3'
(R):5'- TGTAACCAAATGATTCCAGGGG -3'

Sequencing Primer
(F):5'- CCAATTTATGCATTTGTGGGAGACTC -3'
(R):5'- GTAACCAAATGATTCCAGGGGTACTC -3'
Posted On2016-06-21