Incidental Mutation 'R5152:Il23r'
ID395440
Institutional Source Beutler Lab
Gene Symbol Il23r
Ensembl Gene ENSMUSG00000049093
Gene Nameinterleukin 23 receptor
Synonyms
MMRRC Submission 042734-MU
Accession Numbers

Ncbi RefSeq: NM_144548.1; MGI:2181693

Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location67422932-67491855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 67423741 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 535 (N535I)
Ref Sequence ENSEMBL: ENSMUSP00000113342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118364]
Predicted Effect probably damaging
Transcript: ENSMUST00000118364
AA Change: N535I

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113342
Gene: ENSMUSG00000049093
AA Change: N535I

DomainStartEndE-ValueType
FN3 140 220 1e-1 SMART
Blast:FN3 235 317 2e-38 BLAST
transmembrane domain 388 410 N/A INTRINSIC
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype Strain: 4355925
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a subunit of the receptor for IL23A/IL23. This protein pairs with the receptor molecule IL12RB1/IL12Rbeta1, and both are required for IL23A signaling. This protein associates constitutively with Janus kinase 2 (JAK2), and also binds to transcription activator STAT3 in a ligand-dependent manner. [provided by RefSeq, Jul 2008]
PHENOTYPE: Th17 T cells from homozygous null mice have less secretion of IL-9 upon secondary stimulation. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(6)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Itgae G C 11: 73,130,995 G901R probably damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Il23r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:Il23r APN 6 67423628 missense probably damaging 0.96
IGL00886:Il23r APN 6 67473890 missense possibly damaging 0.94
IGL00916:Il23r APN 6 67473931 missense probably damaging 1.00
IGL01102:Il23r APN 6 67423925 missense probably damaging 0.98
IGL01466:Il23r APN 6 67426642 missense probably benign 0.30
IGL01627:Il23r APN 6 67423428 missense probably benign 0.17
IGL02160:Il23r APN 6 67423578 missense probably benign 0.09
IGL02394:Il23r APN 6 67466272 splice site probably benign
IGL02418:Il23r APN 6 67490672 missense possibly damaging 0.46
IGL02818:Il23r APN 6 67486094 critical splice donor site probably null
IGL03230:Il23r APN 6 67423964 missense probably benign 0.31
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0029:Il23r UTSW 6 67478945 critical splice donor site probably null
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0035:Il23r UTSW 6 67473788 splice site probably benign
R0085:Il23r UTSW 6 67486222 missense probably damaging 1.00
R0477:Il23r UTSW 6 67452377 missense probably benign 0.00
R0534:Il23r UTSW 6 67426588 missense probably benign 0.00
R0547:Il23r UTSW 6 67423701 missense probably benign 0.05
R0547:Il23r UTSW 6 67486251 missense possibly damaging 0.57
R0666:Il23r UTSW 6 67434680 missense probably benign 0.08
R0702:Il23r UTSW 6 67466285 missense probably damaging 0.97
R0715:Il23r UTSW 6 67486333 missense possibly damaging 0.63
R1077:Il23r UTSW 6 67473810 missense probably benign 0.40
R1202:Il23r UTSW 6 67478953 missense possibly damaging 0.95
R1328:Il23r UTSW 6 67491818 start gained probably benign
R1378:Il23r UTSW 6 67452410 missense possibly damaging 0.68
R1420:Il23r UTSW 6 67486197 missense probably damaging 1.00
R1475:Il23r UTSW 6 67452296 critical splice donor site probably null
R1628:Il23r UTSW 6 67423609 missense probably damaging 1.00
R1745:Il23r UTSW 6 67466291 missense probably damaging 0.98
R1887:Il23r UTSW 6 67473801 missense possibly damaging 0.88
R1901:Il23r UTSW 6 67423734 missense probably benign 0.44
R1902:Il23r UTSW 6 67423734 missense probably benign 0.44
R1928:Il23r UTSW 6 67423735 missense possibly damaging 0.79
R1984:Il23r UTSW 6 67490668 splice site probably null
R1985:Il23r UTSW 6 67490668 splice site probably null
R2264:Il23r UTSW 6 67426667 critical splice acceptor site probably null
R2290:Il23r UTSW 6 67423861 missense probably benign 0.17
R2363:Il23r UTSW 6 67452417 missense probably benign 0.08
R3430:Il23r UTSW 6 67452474 missense probably benign 0.08
R3964:Il23r UTSW 6 67466297 missense probably benign 0.13
R4073:Il23r UTSW 6 67486122 missense probably damaging 1.00
R4164:Il23r UTSW 6 67423663 missense probably benign 0.00
R4643:Il23r UTSW 6 67423993 missense probably benign 0.08
R4700:Il23r UTSW 6 67473850 missense probably damaging 1.00
R4703:Il23r UTSW 6 67490702 missense probably damaging 1.00
R4720:Il23r UTSW 6 67423661 missense probably damaging 1.00
R4828:Il23r UTSW 6 67431651 missense probably benign 0.31
R4911:Il23r UTSW 6 67423561 missense probably benign 0.17
R5119:Il23r UTSW 6 67466316 missense probably damaging 1.00
R5223:Il23r UTSW 6 67486170 missense probably benign 0.23
R5271:Il23r UTSW 6 67423696 missense probably benign 0.16
R5330:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5331:Il23r UTSW 6 67423495 missense probably damaging 1.00
R5384:Il23r UTSW 6 67486291 missense probably benign 0.10
R5874:Il23r UTSW 6 67431645 missense possibly damaging 0.92
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6037:Il23r UTSW 6 67478954 missense probably damaging 0.99
R6377:Il23r UTSW 6 67423652 missense probably damaging 0.99
R6925:Il23r UTSW 6 67423493 missense probably damaging 1.00
R6975:Il23r UTSW 6 67423368 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAAACGATGCTGGTTTCCTCC -3'
(R):5'- TGAAATCTCTCCCCTGGAACAC -3'

Sequencing Primer
(F):5'- ATGCTGGTTTCCTCCTGTCTTGAG -3'
(R):5'- TCTCTCCCCTGGAACACAAACC -3'
Posted On2016-06-21