Incidental Mutation 'R5152:Itgae'
ID395459
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Nameintegrin alpha E, epithelial-associated
SynonymsCD103, alpha-E1
MMRRC Submission 042734-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5152 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location73090583-73147446 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 73130995 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 901 (G901R)
Ref Sequence ENSEMBL: ENSMUSP00000099596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000052140] [ENSMUST00000102537]
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: G901R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: G901R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000052140
SMART Domains Protein: ENSMUSP00000055806
Gene: ENSMUSG00000050107

DomainStartEndE-ValueType
low complexity region 61 67 N/A INTRINSIC
low complexity region 74 89 N/A INTRINSIC
low complexity region 95 106 N/A INTRINSIC
low complexity region 357 378 N/A INTRINSIC
SCOP:d1h8fa_ 437 619 1e-8 SMART
DUF3635 664 753 3.83e-45 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: G901R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: G901R

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 99% (83/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca16 T C 7: 120,540,623 S1503P probably benign Het
Actn3 C A 19: 4,863,544 V620F probably damaging Het
Adamtsl3 A G 7: 82,574,544 K252E probably benign Het
Adgrg1 A G 8: 95,009,745 Y509C probably damaging Het
Arhgef2 G A 3: 88,629,568 probably null Het
Bod1l T C 5: 41,816,543 E2476G probably benign Het
C130026I21Rik G A 1: 85,261,860 P19S probably benign Het
Capn3 T C 2: 120,501,330 probably benign Het
Catsperz T C 19: 6,923,337 T147A probably benign Het
Cc2d1b C A 4: 108,626,086 A289E probably benign Het
Ccdc170 A C 10: 4,561,107 H722P probably damaging Het
Cdk13 C A 13: 17,718,525 A1358S probably benign Het
Cntn6 T A 6: 104,569,113 probably benign Het
Coch A G 12: 51,595,442 N66D probably benign Het
Col12a1 A G 9: 79,656,748 S1732P probably damaging Het
Copa T A 1: 172,118,061 V917E probably benign Het
Csmd2 C A 4: 128,552,035 N3299K probably benign Het
Cyp2c67 A T 19: 39,638,688 F233I probably benign Het
D630039A03Rik T A 4: 57,910,434 H126L probably damaging Het
Ddx46 T C 13: 55,659,030 L492P probably damaging Het
Dpysl3 C T 18: 43,438,080 G43D probably benign Het
Enpp5 C T 17: 44,081,133 P151L probably damaging Het
Exoc3l4 T C 12: 111,430,893 probably benign Het
Faap100 T A 11: 120,377,632 E105V possibly damaging Het
Flg2 C A 3: 93,214,977 P1485T unknown Het
Fmo5 A G 3: 97,641,762 Y242C probably benign Het
Fsip2 C A 2: 82,978,572 T1745N probably benign Het
Gata4 T A 14: 63,241,121 N10Y probably damaging Het
Gm10722 A C 9: 3,001,041 Y39S probably benign Het
Gm4787 A C 12: 81,378,677 S236A probably benign Het
Gm9125 T C 3: 94,050,144 probably benign Het
Golga7 A C 8: 23,245,949 S94A probably benign Het
Gpbp1 A G 13: 111,453,281 probably benign Het
Grm1 A G 10: 11,079,875 Y222H probably benign Het
Gstcd A G 3: 133,084,956 Y17H possibly damaging Het
Hephl1 C A 9: 15,080,185 D586Y probably damaging Het
Hpn C A 7: 31,099,836 V35L probably damaging Het
Il23r T A 6: 67,423,741 N535I probably damaging Het
Inpp4a T C 1: 37,358,535 I45T possibly damaging Het
Kif28 T C 1: 179,702,538 D686G probably damaging Het
Kit A G 5: 75,620,847 E312G probably benign Het
Lamb2 C A 9: 108,487,738 S1230R probably benign Het
Lars A T 18: 42,228,777 D588E possibly damaging Het
Lgr4 T A 2: 110,000,603 F292I probably damaging Het
Lmf1 C T 17: 25,655,519 S458L probably damaging Het
Lpin2 T A 17: 71,245,159 C787S probably damaging Het
Ms4a4a A C 19: 11,388,312 I138L probably benign Het
Mterf1a A T 5: 3,890,984 F295I probably damaging Het
Muc4 A T 16: 32,757,058 K241* probably null Het
Muc5b T C 7: 141,865,531 F4017S possibly damaging Het
Nfkbil1 T C 17: 35,221,408 probably benign Het
Olfr1269 A G 2: 90,119,121 L159P probably damaging Het
Olfr935 A T 9: 38,995,177 V86E possibly damaging Het
Olfr976 T C 9: 39,956,906 T22A probably benign Het
Osgep T C 14: 50,917,858 D81G probably damaging Het
Otos A G 1: 92,644,394 F70S probably damaging Het
Pcdhb2 T A 18: 37,296,126 V384D probably damaging Het
Ppp1r10 C T 17: 35,929,252 P514S probably damaging Het
Pramef17 G A 4: 143,994,260 P37L probably damaging Het
Prdm16 A G 4: 154,346,102 Y309H probably damaging Het
Rap1gds1 A T 3: 138,956,201 D382E probably damaging Het
Reln A G 5: 21,948,629 F2226L probably damaging Het
Rmi2 C T 16: 10,839,901 T125M probably damaging Het
Setd1a C T 7: 127,784,025 T231I probably benign Het
Sftpa1 G A 14: 41,134,352 G218D probably damaging Het
Shcbp1 A T 8: 4,736,138 F655I probably damaging Het
Slc5a7 T C 17: 54,278,833 I319V possibly damaging Het
Spata31d1c C T 13: 65,035,595 T317I probably damaging Het
Speg C T 1: 75,428,098 P2845S possibly damaging Het
Synpo2 A G 3: 123,235,901 probably null Het
Tdrd7 T A 4: 46,013,191 S644T probably damaging Het
Tmem182 T A 1: 40,838,300 Y112N probably damaging Het
Usp45 T A 4: 21,824,815 N522K probably benign Het
Vnn3 A T 10: 23,864,339 Y180F probably benign Het
Wnk1 C T 6: 120,002,280 R282Q possibly damaging Het
Xrn1 A T 9: 95,964,065 D57V probably benign Het
Zfp831 T C 2: 174,644,564 V344A probably benign Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 unclassified probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7069:Itgae UTSW 11 73116143 missense probably damaging 0.99
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACCACTTCTTTTCCTCAAGGG -3'
(R):5'- AGACTCTGCACACTCCTCTG -3'

Sequencing Primer
(F):5'- CTCCAGAGGACCTAGGTTTGAATC -3'
(R):5'- TCTGTGCGCCACTTGAG -3'
Posted On2016-06-21